Tách dòng và so sánh trình tự gen mã hoá LTP liên quan đến khả năng chịu hạn của một số giống đậu xanh (Vigna radiata L. Wilczek)

Kết quả phân tích cho thấy, giữa giống đậu xanh 044/ĐX06 và HN 2 có độ tƣơng đồng về trình tự amino acid trong protein của gen LTP đạt 95,6% với 5 vị trí sai khác là 36, 37, 38, 101 và 105. So sánh trình tự amino acid trong protein của gen LTP ở giống đậu xanh 044/ĐX06 và HN 2 với giống đậu xanh có mã số AY300807 cũng đƣợc thể hiện ở hình 6. Qua hình 6 cho thấy, độ tƣơng đồng về trình tự amino acid trong protein của gen LTP ở giống đậu xanh có mã số AY300807 với giống đậu xanh 044/ĐX06 và HN 2 lần lƣợt là 98,2% và 97,4%. Sự sai khác về trình tự nucleotide và trình tự amino acid ở trên là cơ sở để chúng tôi có những nghiên cứu tiếp theo trên nhiều giống đậu xanh hơn nữa và so sánh giữa hai nhóm chịu hạn tốt và kém nhằm tìm kiếm sự thay đổi vị trí các nucleotide và amino acid liên quan đến tính trạng chịu hạn của các giống đậu xanh

pdf7 trang | Chia sẻ: yendt2356 | Lượt xem: 376 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Tách dòng và so sánh trình tự gen mã hoá LTP liên quan đến khả năng chịu hạn của một số giống đậu xanh (Vigna radiata L. Wilczek), để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nguyễn Vũ Thanh Thanh Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 133 - 138 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 110 TÁCH DÒNG VÀ SO SÁNH TRÌNH TỰ GEN MÃ HOÁ LTP LIÊN QUAN ĐẾN KHẢ NĂNG CHỊU HẠN CỦA MỘT SỐ GIỐNG ĐẬU XANH (Vigna radiata L. Wilczek) Nguyễn Vũ Thanh Thanh1*, Phạm Thị Oanh2, Chu Hoàng Mậu3 1Trường Đại học Khoa học- ĐH Thái Nguyên , 2Trường Đại học Sư phạm- ĐH Thái Nguyên 3Đại học Thái Nguyên TÓM TẮT LTP (Lipid Transfer Protein) thuộc họ gen pathogenesis relate, đƣợc xác định có liên quan với khả năng chịu hạn ở thực vật. Trong nghiên cứu này chúng tôi trình bày kết quả so sánh khả năng chịu hạn và phân lập gen LTP liên quan đến khả năng chịu hạn ở giống đậu xanh 044/ĐX06 và HN2. Gen LTP ở giống đậu xanh 044/ĐX06 và HN2 đều có kích thƣớc 351 bp, chuỗi polypeptide đƣợc tổng hợp từ gen LTP gồm 116 amino acid. Khi so sánh với trình tự nucleotide của gen LTP đã công bố trên ngân hàng gen quốc tế (NCBI) với mã số AY300807, trình tự nucleotide của gen LTP ở hai mẫu nghiên cứu có độ tƣơng đồng 98,8%. Độ tƣơng đồng về trình tự amino acid trong protein từ 97,4% - 98,2%. Cần có những nghiên cƣ́u tiếp theo để xác đị nh mối liên quan giƣ̃a sƣ̣ thay đổi trong cấu trúc gen với đặc tính chịu hạn của cây đậu xanh . Từ khoá: chịu hạn, đậu xanh, gen LTP, PCR, vigna radiata MỞ ĐẦU Đậu xanh (Vigna radiata L.Wilczek) là loại cây trồng thuộc họ đậu, không chỉ có ý nghĩa về mặt kinh tế và dinh dƣỡng mà còn có ý nghĩa quan trọng trong việc cải tạo độ phì của đất. Trong những năm gần đây hạn hán xảy ra thƣờng xuyên đã tác động xấu đến sự sinh trƣởng, phát triển, làm giảm năng suất và sản lƣợng cây trồng trong đó có đậu xanh. Vì vậy, chọn giống chịu hạn và nâng cao tính chịu hạn của cây trồng là vấn đề cần thiết. Một số nghiên cứu về khả năng chịu hạn đã đƣợc tiến hành trên một số loại cây trồng nhƣ đậu tƣơng, ngô, lúa [1], [2]. Các nghiên cứu đều thống nhất rằng đặc tính chịu hạn của cây trồng rất phức tạp do nhiều gen quy định, trong đó có gen LTP (Lipid Transfer Protein). LTP thuộc họ gen pathogenesis relate, có khả năng tổng hợp ra protein thúc đẩy quá trình vận chuyển phospholipid giữa các màng. Vai trò của LTP là tham gia vào cấu tạo lớp sáp hoặc lớp biểu bì giúp thực vật bảo vệ, phản ứng và đáp ứng lại những thay đổi của môi trƣờng. Những phân tử protein LTP thƣờng bao gồm nhiều đặc điểm chung nhƣ: điểm  Tel: 0912664126; Email: thanhthanhdhkhtn@gmail.com đẳng điện cao, khối lƣợng phân tử khoảng 9,12 kDa và sự có mặt của 8 phân tử cystein làm nhiệm vụ tạo ra 4 cầu nối disulfide [5]. Trong bài báo này chúng tôi công bố kết quả so sánh khả năng chịu hạn và phân lập gen LTP ở các giống đậu xanh (Vigna radiata L.Wilczek) chịu hạn khác nhau. VẬT LIỆU VÀ PHƢƠNG PHÁP Vật liệu: Hạt của 13 giống đậu xanh do Viện nghiên cứu Ngô cung cấp và một số giống thu thập tại các tỉnh Bắc Giang, Thái Nguyên, Lạng Sơn, Hà Nội, Hà Giang. Danh sách các giống đậu xanh nghiên cứu đƣợc trình bày trong Bảng 1. Phương pháp: Đánh giá nhanh khả năng chịu hạn theo phƣơng pháp của Lê Trần Bình và cs (1998) [1]. Tách chiết DNA tổng số theo Gawel và Jarret (1991) [3]. Nhân gen LTP bằng kỹ thuật PCR theo Mullis và cs (1985) với cặp mồi đặc hiệu đƣợc trình bày trong Bảng 2. Sản phẩm PCR đƣợc điện di kiểm tra trên gel agarose 1%. Sau đó, sản phẩm đƣợc tinh sạch theo bộ Kit DNA extraction Kit K05013 của hãng Fermentas rồi đƣợc gắn trực tiếp vào vector tách dòng pBT, sau đó đƣợc biến nạp vào tế bào khả biến E.coli DH5α. Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 111 Bảng 1. Nguồn gốc của các giống đậu xanh nghiên cứu TT Tên giống Nguồn gốc 1 ĐXVN 4 Do Viện NC Ngô lai tạo giữa giống Mungo 113 với ĐX 113 2 ĐXVN 5 Do Viện NC Ngô lai tạo giữa giống ĐX 04 với ĐX 113 3 VN 99-3 Do Viện NC Ngô lai tạo giữa giống VN 93-1 với Vigna mungo 4 044/ĐX06 Do Viện NC Ngô lai tạo giữa giống ĐX 044 với ĐX 06 5 TN Đồng Hỷ - Thái Nguyên 6 LS Bắc Sơn - Lạng Sơn 7 HN 1 Ba Vì - Hà Nội 8 HN 2 Mỹ Đức - Hà Nội 9 BG 1 Việt Yên - Bắc Giang 10 BG 2 Yên Dũng - Bắc Giang 11 BG 3 Sơn Động - Bắc Giang 12 HG 1 Bắc Quang - Hà Giang 13 HG 2 Hoàng Su Phì - Hà Giang Bảng 2. Trình tự cặp mồi nhân gen LTP Mồi Trình tự mồi (5’-3’) Vig-LTP-F ATGGCTAGCCTGAAGGTTGC Vig-LTP-R TTACTTGATGTTAGCGCAGTT Tách plasmid mang gen LTP phục vụ cho đọc trình tự gen bằng bộ Kit AccuPrep Plasmid Extraction của hãng Bioneer. Kiểm tra sản phẩm tách plasmid trên gel agarose 1% sau đó tiến hành đọc trình tự của gen trên máy đọc trình tự nucleotide tự động ABI PRISM@ 3100 Advant Genetic Analyzer (Applied Biosystem) sử dụng bộ hoá chất sinh chuẩn BigDye  Terminator v3.1 Cycle Sequencing. KẾT QUẢ VÀ THẢO LUẬN Kết quả đánh giá khả năng chịu hạn ở giai đoạn cây non Để đánh giá khả năng chịu hạn của các giống đậu xanh nghiên cứu góp phần định hƣớng cho việc chọn các giống đậu xanh chịu hạn có hiệu quả, chúng tôi tiến hành nghiên cứu, đánh giá nhanh khả năng chịu hạn của các giống đậu xanh ở giai đoạn cây non theo các chỉ tiêu: tỉ lệ cây không héo, tỉ lệ cây phục hồi sau 3, 5, 7, 9, 11 ngày thí nghiệm. Từ đó xác định chỉ số chịu hạn tƣơng đối của các giống đậu xanh. Giống nào có chỉ số chịu hạn tƣơng đối càng lớn thì khả năng chịu hạn càng cao và ngƣợc lại. Kết quả đánh giá nhanh khả năng chịu hạn ở giai đoạn cây non của các giống đậu xanh nghiên cứu đƣợc trình bày ở bảng 3. Kết quả ở bảng 3 cho thấy giống 044/ĐX06 là giống chịu hạn tốt nhất với chỉ số chịu hạn 9174. Còn giống HN 2 là giống chịu hạn kém nhất với chỉ số chịu hạn là 2467. Khả năng chịu hạn của các giống đậu xanh nghiên cứu có thể xếp theo thứ tự giảm dần nhƣ sau: 044/ĐX06 > BG 3 > HG 1> HG 2 > LS > ĐXVN 4> BG 2 > BG 1 > ĐXVN 5 > TN > VN 99-3 > HN 1 > HN2. Từ kết quả đánh giá khả năng chịu hạn ở trên, chúng tôi lựa chọn giống có chỉ số chịu hạn cao nhất là 044/ĐX06 và giống có chỉ số chịu hạn thấp nhất HN2 để tiếp tục nghiên cứu phân lập gen LTP. Kết quả nhân gen LTP Đoạn gen LTP đƣợc nhân từ DNA tổng số bằng phƣơng pháp PCR. Kết quả nhân gen đƣợc kiểm tra bằng phƣơng pháp điện di trên gel agarose 1% trong TAE 1X, với sự có mặt của marker chuẩn và chụp ảnh dƣới ánh sáng cực tím. Kết quả điện di đƣợc thể hiện ở Hình 1. Qua Hình 1 cho thấy, đã nhân đƣợc một đoạn DNA đặc hiệu có kích thƣớc khoảng 350 bp, Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 112 hàm lƣợng của sản phẩm đủ lớn để thực hiện cho các nghiên cứu tiếp theo. Bảng 3. Khả năng chịu hạn ở giai đoạn cây non của các giống đậu xanh nghiên cứu Tên giống Chỉ số chịu hạn Thứ tự về khả năng chịu hạn Tên giống Chỉ số chịu hạn Thứ tự về khả năng chịu hạn ĐXVN 4 5524,45 6 HN 2 2467,19 13 ĐXVN 5 4287,94 9 BG 1 4434,88 8 VN 99-3 2914,50 11 BG 2 4585,02 7 044/ĐX06 9173,77 1 BG3 7767,65 2 TN 4108,86 10 HG 1 6487,55 3 LS 5626,05 5 HG 2 5939,80 4 HN 1 2859,00 12 Độ dài của đoạn DNA vừa nhân đƣợc cũng phù hợp với lý thuyết khi chúng tôi thiết kế mồi và chiều dài cũng tƣơng tự nhƣ với gen LTP đã đăng ký trên Ngân hàng gen Quốc tế với mã số AY300807. Hình 1. Hình ảnh điện di kết quả nhân gen LTP Kí hiệu: M. Marker 1 Kb; 1. 044/ĐX06; 2. HN 2 Kết quả biến nạp vector tái tổ hợp vào tế bào khả biến E.coli DH5α Sản phẩm PCR sau khi đƣợc tinh sạch đƣợc gắn vào vector tách dòng pBT nhờ enzyme nối T4 ligase. Hỗn hợp đƣợc ủ ở 220C trong 1h cho phản ứng xảy ra hoàn toàn, sau đó đƣợc biến nạp vào tế bào khả biến chủng E.coli DH5α và đƣợc cấy trải trên môi trƣờng LB đặc (pepton, cao nấm men, NaCl, agarose) có bổ sung kháng sinh ampicillin (100mg/l), X-gal (40mg/l) và IPTG (100µM). Ủ đĩa ở 37 0C trong 16 giờ. Kết quả thu đƣợc có cả khuẩn lạc màu xanh và màu trắng (Hình 2). Tiến hành chọn 4 khuẩn lạc có màu trắng chuyển sang nuôi trong môi trƣờng LB lỏng (có bổ sung ampicillin 100mg/l) qua đêm để thực hiện clony-PCR với cặp mồi pUC 18 nhằm xác định khuẩn lạc có mang gen mong muốn. Kết quả thực hiện phản ứng clony-PCR đƣợc thể hiện ở Hình 3. Vì pUC là mồi thiết kế chung cho các vector tách dòng nên khi kiểm tra sản phẩm clony-PCR vừa dòng hoá thì kích thƣớc của đoạn gen sẽ cao hơn 124 bp. Điều này có nghĩa là kích thƣớc của đoạn gen vừa nhân khoảng 474 bp. Nhƣ vậy, tất cả hai mẫu đều cho một băng duy nhất đúng kích thƣớc, chứng tỏ kết quả biến nạp và chọn dòng đã đƣợc thực hiện tốt, phản ứng PCR đã đạt mức tối ƣu. Hình 2. Hình ảnh khuẩn lạc M 1 2 500 bp   350 bp M 1 2 474 bp Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 113 Hình 3. Kết quả điện di sản phẩm clony-PCR Kí hiệu: M. Marker 1Kb; 1. 044/ĐX06; 2. HN 2 Kết quả tách plasmid từ các khuẩn lạc của 2 mẫu nghiên cứu Sau khi kết quả biến nạp và chọn dòng đã đƣợc thực hiện tốt, phản ứng PCR đã đạt mức tối ƣu, chúng tôi tiếp tục tiến hành tách plasmid theo bộ Kit AccuPrep Plasmid Extraction của hãng Bioneer. Kết quả điện di sản phẩm tách plasmid mang gen LTP của hai giống đậu xanh nghiên cứu đƣợc thể hiện ở Hình 4. Kết quả điện di ở Hình 4 cho thấy, sản phẩm tách plasmid sạch, đảm bảo chất lƣợng và số lƣợng phục vụ cho việc xác định trình tự nucleotide. Hình 4. Kết quả điện di sản phẩm tách plasmid mang gen LTP của giống đậu xanh 044/ĐX06 và HN 2 Kí hiệu: 1. 044/ĐX06; 2. HN 2 Kết quả xác định và so sánh trình tự nucleotide của gen LTP Để xác định chính xác trình tự nucleotide của gen LTP đã đƣợc tách dòng, chúng tôi tiến hành đọc trình tự nucleotide của gen LTP trên máy đọc trình tự nucleotide tự động ABI PRISM@ 3100 Advant Genetic Analyzer. Kết quả đƣợc xử lý bằng phần mềm DNAstar và so sánh trình tự này trong BLAST của ngân hàng NCBI cho thấy đây là trình tự gen LBT của đậu xanh có kích thƣớc mong muốn dài 351 bp. Chúng tôi tiến hành so sánh trình tự nucleotide của gen LTP phân lập từ giống đậu xanh 044/ĐX06 và HN2. Mức độ tƣơng đồng về trình tự nucleotide của giống đậu xanh chịu hạn tốt 044/ĐX06 với giống đậu xanh chịu hạn kém HN2 đạt 97,7% (chỉ sai khác 8 nucleotide lần lƣợt ở các vị trí 107, 108, 109, 113, 276, 302, 313 và 314). Từ kết quả xác định trình tự ở trên, chúng tôi tiếp tục so sánh trình tự gen LTP của hai giống đậu xanh nghiên cứu với trình tự của giống đậu xanh trên Ngân hàng gen Quốc tế có mã số AY300807[4]. Kết quả so sánh trình tự nucleotide đƣợc thể hiện ở Hình 5. Trình tự nucleotide của gen LTP ở giống đậu xanh 044/ĐX06 và HN 2 đều có hệ tƣơng đồng với trình tự nucleotide của giống đã công bố với mã số AY300807 là 98,8%. So sánh trình tự amino acid trong protein của gen LTP ở giống đậu xanh 044/ĐX06 và HN 2 cho kết quả đƣợc thể hiện ở Hình 6. Kết quả phân tích cho thấy, giữa giống đậu xanh 044/ĐX06 và HN 2 có độ tƣơng đồng về trình tự amino acid trong protein của gen LTP đạt 95,6% với 5 vị trí sai khác là 36, 37, 38, 101 và 105. So sánh trình tự amino acid trong protein của gen LTP ở giống đậu xanh 044/ĐX06 và HN 2 với giống đậu xanh có mã số AY300807 cũng đƣợc thể hiện ở hình 6. Qua hình 6 cho thấy, độ tƣơng đồng về trình tự amino acid trong protein của gen LTP ở giống đậu xanh có mã số AY300807 với giống đậu xanh 044/ĐX06 và HN 2 lần lƣợt là 98,2% và 97,4%. Sự sai khác về trình tự nucleotide và trình tự amino acid ở trên là cơ sở để chúng tôi có những nghiên cứu tiếp theo trên nhiều giống đậu xanh hơn nữa và so sánh giữa hai nhóm chịu hạn tốt và kém nhằm tìm kiếm sự thay đổi vị trí các nucleotide và amino acid liên quan đến tính trạng chịu hạn của các giống đậu xanh. KẾT LUẬN Đã khuếch đại thành công, chọn dòng và đọc trình tự gen LTP của giống đậu xanh chịu hạn tốt (044/ĐX06) và giống đậu xanh chịu hạn kém (HN2). Chiều dài gen LTP ở hai giống đậu xanh trên có kích thƣớc 351 bp với độ tƣơng đồng là 97,7 %. Độ tƣơng đồng về trình tự amino acid trong protein của gen LTP ở hai giống đậu xanh trên đạt 95,6%. Độ tƣơng đồng giữa trình tự gen LTP của hai giống đậu xanh nghiên cứu với trình tự gen LTP trên đậu xanh đã đƣợc công bố trong ngân hàng gen đều là 98,8 %. Độ tƣơng đồng về trình tự amino acid trong protein của Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 114 gen LTP ở giống đậu xanh có mã số AY300807 với giống đậu xanh 044/ĐX06 và HN 2 lần lƣợt là 98,2 % và 97,4%. ....|....| ....|....| ....|....| ....|....| ....|....| 10 20 30 40 50 AY300807 ATGGCTAGCC TGAAGGTTGC ATGCATGGTT GCGGTGGTGT TCATGGTCGT 044/ĐX06 ATGGCTAGCC TGAAGGTTGC ATGCATGGTT GCGGTGGTGT TCATGGTCGT HN 2 ATGGCTAGCC TGAAGGTTGC ATGCATGGTT GCGGTGGTGT TCATGGTCGT ....|....| ....|....| ....|....| ....|....| ....|....| 60 70 80 90 100 AY300807 GGTGAGTGCA CATATGGCAC ATGCGATCAC GTGCGGGCAA GTGGCCTCTT 044/ĐX06 GGTGAGTGCA CATATGGCAC ATGCGATCAC GTGCGGGCAA GTGGCCTCTT HN 2 GGTGAGTGCA CATATGGCAC ATGCGATCAC GTGCGGGCAA GTGGCCTCTT ....|....| ....|....| ....|....| ....|....| ....|....| 110 120 130 140 150 AY300807 CTTTGGCTCC ATGCATCTCC TACCTCCAAA AGGGCGGAGT TCCGTCGGCG 044/ĐX06 CTTTGGCTCC ATGCATCTCC TACCTCCAAA AGGGCGGAGT TCCGTCGGCG HN 2 CTTTGGAATC ATCCATCTCC TACCTCCAAA AGGGCGGAGT TCCGTCGGCG ....|....| ....|....| ....|....| ....|....| ....|....| 160 170 180 190 200 AY300807 TCGTGTTGCA GCGGAGTGAA GGCCCTGAAC AGCGCCGCAA GTACCACCGC 044/ĐX06 TCGTGTTGCA GCGGAGTGAA GGCCCTGAAC AGCGCCGCAA GTACCACCGC HN 2 TCGTGTTGCA GCGGAGTGAA GGCCCTGAAC AGCGCCGCAA GTACCACCGC ....|....| ....|....| ....|....| ....|....| ....|....| 210 220 230 240 250 AY300807 TGACCGCAAA ACCGCGTGCA ACTGTCTGAA AAACCTTGCC GGTCCAAAGT 044/ĐX06 TGACCGCAAA ACCGCGTGCA ACTGTCTGAA AAACCTTGCC GGTCCAAAGT HN 2 TGACCGCAAA ACCGCGTGCA ACTGTCTGAA AAACCTTGCC GGTCCAAAGT ....|....| ....|....| ....|....| ....|....| ....|....| 260 270 280 290 300 AY300807 CGGGTATCAA CGAGGGCAAC GCCGCTTCAC TCCCAGGCAA ATGTAAAGTC 044/ĐX06 CGGGTATCAA CGAGGGCAAC GCCGCATCAC TCCCAGGCAA ATGTAAAGTC HN 2 CGGGTATCAA CGAGGGCAAC GCCGCTTCAC TCCCAGGCAA ATGTAAAGTC ....|....| ....|....| ....|....| ....|....| ....|....| 310 320 330 340 350 AY300807 AACGTGCCCT ACAAGATCAG CACCTTCACC AACTGCGCTA ACATCAAGTA 044/ĐX06 ATCGTGCCCT ACTGGATCAG CACCTTCACC AACTGCGCTA ACATCAAGTA HN 2 AACGTGCCCT ACAAGATCAG CACCTTCACC AACTGCGCTA ACATCAAGTA . AY300807 A 044/ĐX06 A HN 2 A Hình 5. So sánh trình tự nucleotide của gen LTP ở giống đậu xanh 044/ĐX06 và HN 2 với trình tự đã công bố AY300807 ....|....| ....|....| ....|....| ....|....| ....|....| 10 20 30 40 50 AY300807 MASLKVACMV AVVFMVVVSA HMAHAITCGQ VASSLAPCIS YLQKGGVPSA 044/ĐX06 MASLKVACMV AVVFMVVVSA HMAHAITCGQ VASSLAPCIS YLQKGGVPSA HN 2 MASLKVACMV AVVFMVVVSA HMAHAITCGQ VASSLESSIS YLQKGGVPSA ....|....| ....|....| ....|....| ....|....| ....|....| Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 115 60 70 80 90 100 AY300807 SCCSGVKALN SAASTTADRK TACNCLKNLA GPKSGINEGN AASLPGKCKV 044/ĐX06 SCCSGVKALN SAASTTADRK TACNCLKNLA GPKSGINEGN AASLPGKCKV HN 2 SCCSGVKALN SAASTTADRK TACNCLKNLA GPKSGINEGN AASLPGKCKV ....|....| ....|. 110 AY300807 NVPYKISTFT NCANIK 044/ĐX06 IVPYWISTFT NCANIK HN 2 NVPYKISTFT NCANIK Hình 6. So sánh trình tự amino acid trong protein của gen LTP ở giống đậu xanh 044/ĐX06, HN 2 và AY300807 TÀI LIỆU THAM KHẢO [1] Lê Trần Bình và cs (1998), Công nghệ sinh học thực vật trong cải tiến giống cây trồng, Nxb Nông nghiệp, Hà Nội. [2] Lê Trần Bình, Lê Thị Muội (1998), Phân lập gen và chọn dòng chống chịu ngoại cảnh bất lợi ở cây lúa, Nxb Đại học Quốc Gia, Hà Nội. [3] Gawel N.J., Jarret R.H. (1991), Genomic DNA isolation. [4] [5] Kader J.C. (1996), “Lipid-transfer proteins in plants”, Annual Review of Plant Physiology Plant Molecular Biology , 47, pp: 627-654. LỜI CẢM ƠN: Công trình được thực hiện với sự hỗ trợ của đề tài Khoa học-Công nghệ cấp Bộ 2010-TN09-01. SUMMARY CLONING AND COMPARATIVE OF SEQUENCE OF GENE ENCODING LIPID TRANSFER PROTEIN RELATED TO THE ABILITY OF DROUGHT RESISTANCE OF SOME MUNGBEAN CULTIVARS (Vigna radiata L. Wilczek) Nguyen Vu Thanh Thanh 1 , Pham Thi Oanh 2 , Chu Hoang Mau 3 1 College of Science - TNU, 2 College of Education - TNU, 3 Thai Nguyen University LTP property family gene pathogenesis relate have been identified that are related to the drought-resistant ability of plant. In this study, we present the results of comparative ability of drought resistance in mungbean and isolation LTP gene related to the ability of drought resistance of the local 044/ĐX06 and HN 2 mungbean cutivals. LTP gene of the local 044/ĐX06 and HN 2 mungbean cutivals have size of 351bp, it have been synthetic polypeptit chain has 116 amino acids. When compared with the nucleotide sequence of the LTP gene in mungbean cultivar, it has been published on the international GeneBank (NCBI) with AY300807 code, the LTP gene of local 044/ĐX06 and HN 2 mungbean cultivars have the similarities level 98,8%. The similarities level of amino acid of protein is 97,4% - 98,2%. Continued studies are needed to determine the relationship between change in structure of gene and drought-resistant ability of mungbean cultivars. Key words: drought-resistant, LTP gene, mungbeans, PCR, vigna radiata Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 72(10): 110 - 115 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên | 116

Các file đính kèm theo tài liệu này:

  • pdfbrief_32724_36565_208201216328110115_2855_2052134.pdf
Tài liệu liên quan