Sinh học - Chapter 23 (part 1): Recombinant DNA technology

Can introduce gene into animals and plants These modified organism are powerful research tools to study the effect of a specific gene product on metabolism, development etc . Has also been used to develop improved agricultural products

ppt17 trang | Chia sẻ: nguyenlam99 | Lượt xem: 1156 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Sinh học - Chapter 23 (part 1): Recombinant DNA technology, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Chapter 23 (Part 1)Recombinant DNA TechnologyCloning VectorRequired featuresOrigin of replicationSelectable markerScreenable marker for recombinant moleculesCloning sitesRestriction Modification SystemAAGATGCGAATTCGTACAAAGATGCGAATTCGTACA**AAGATGCGAATTCGTACA**DNA methylaseRestriction endonucleaseAAGATGCGAATTCGTACAAAGATGCGAATTCGTACAAAGATGCG AATTCGTACADNA methylaseRestriction endonuclease5’ ATGCGAATTCCGGTT 3’3’ TACGCTTAAGGCCTT 5’5’-ATGCG-3’ 5’-AATTCCGGTT-3’3’-TACGCTTAA-5’ 3’-GGCCTT-5’EcoR15’ ATGCGATATCCGGTT 3’3’ TACGCTATAGGCCTT 5’5’-ATGCGAT-3’ 5’-ATCCGGTT-3’3’-TACGCTA-5’ 3’-TAGGCCTT-5’EcoRVSticky-end cutterBlunt-end cutterT4 DNA LigaseTransformationAll of the previous steps were performed in vitro. We have generated a very small amount of a recombinant plasmidNeed to amplify in bacteria to get enough to work with. Transformation – process to mobilize DNA into bacterial hostSelect for transformed bacteria on specific antibiotic that corresponds to the antibiotic resistance gene present on the plasmidHow to produce a recombinant protein10 to 70% of cellular protein 0.1 to 1% of cellular protein cDNAcDNA LibrarycDNADNA hydridization screening for specific geneRequires that you know something about the gene sequenceCan get sequence information form purified proteinProduct name Protein typeApplicationCompanyAdagen (Adenosine deaminase ) An enzymeSevere combined immunodeficiency disease (SCID)EnzonGenotropin (Recombinant growth hormone)A hormoneGrowth hormone deficiency (GHD) in childrenPharmacia & UpjohnHumalog (Recombinant human insulin) A hormoneDiabetesEli LillyNabi-HB (Anti-Hepatitis B) An antibodyHepatitis-B NabiNovo Seven (Recombinant coagulation factor VIIa)A modified factorHemophillia patients with inhibitorsNovo NordiskOntak (Diphtheria toxin-interleukin-2)A fusion proteinCutaneous T-cell lymphoma (CTCL)Ligand PharmaceuticalsRoferon-A (Recombinant interferon alfa-2a) A modifierHairy cell leukemia or AIDS-related Kaposi's sarcomaHoffmann-La RocheGenetic Modification of Higher OrganismsCan introduce gene into animals and plantsThese modified organism are powerful research tools to study the effect of a specific gene product on metabolism, development etc.Has also been used to develop improved agricultural productsGenetically Engineered SalmonIs Bigger Better?

Các file đính kèm theo tài liệu này:

  • pptchapter_23_part_1_lecture_8218.ppt