Phân lập, tuyển chọn nấm men từ trái cây địa phương và thử nghiệm lên men dịch xoài

Tổ ng số 16 chủng nấm men đã được phân lập từ các mẫu trái cây lên men tự nhiên. Kế t quả tuyển chọn 2 chủng N11 và N23 có nguồn gốc từ quả nho lên men tự nhiên có khả năng chịu được nồng độ đường 25% (w/v) và nồng độ rượu 8% (v/v). Các chủng này có khả năng kết lắng tốt >75%, và có khả năng lên men dịch xoài với hiệu suất chuyển hóa đường 56%, độ rượu tạo thành >4,5%. Kết quả định danh cho thấy chủng N11 và N23 có độ tương đồng 99% với chủng Saccharomyces cerevisiae xác định theo Blast.

pdf8 trang | Chia sẻ: linhmy2pp | Ngày: 24/03/2022 | Lượt xem: 162 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phân lập, tuyển chọn nấm men từ trái cây địa phương và thử nghiệm lên men dịch xoài, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 TRƯỜNG ĐẠI HỌC NHA TRANG • 9 PHÂN LẬP, TUYỂN CHỌN NẤM MEN TỪ TRÁ I CÂY ĐỊ A PHƯƠNG VÀ THỬ NGHIỆM LÊN MEN DỊCH XOÀI ISOLATION, SELECTION OF YEASTS ASSOCIATED WITH LOCAL FRUITS AND FERMENTATION OF MANGO JUICE Nguyễn Thị Thanh Hải1, Đỗ Thị Ánh Hòa2 Ngày nhận bài: 19/7/2016; Ngày phản biện thông qua: 15/8/2017; Ngày duyệt đăng: 25/9/2017 TÓM TẮT Sản phẩm nước trái cây lên men đang phát triển mạnh trên thị trường Việt Nam. Việc sử dụng chủng nấm men phù hợp trong quá trình lên men nước trái cây là vấn đề cần quan tâm. Mụ c tiêu củ a nghiên cứ u nà y là phân lập, tuyển chọn nấm men từ các loại trái cây địa phương và thử nghiệm lên men dịch xoài. 16 chủng nấm men đã được phân lập từ các mẫu trái cây lên men tự nhiên, trong đó nghiên cứu tuyển chọn được hai chủng N11 và N23 có khả năng chịu được nồng độ đường 25%w/v, nồng độ cồn 8%v/v và có khả năng kết lắng tốt. Hai chủng này được tiến hành thử nghiệm lên men dịch xoài và cho dịch lên men có nồng độ cồn tương ứng 4,7%v/v và 4,57%v/v. Kết qủa định danh bằng giải trình tự gen 28S rRNA cho thấy cả 2 chủng tuyển chọn đều là Saccharomyces cerevisiae vớ i độ tương đồng 99%. Chủng nấm men tuyển chọn góp phần nâng cao giá trị và ổn định chất lượng sản phẩm, thúc đẩy ngành sản xuất đồ uống trái cây lên men có độ cồn thấp phát triển. Từ khóa: 28S rRNA, dịch xoài lên men, nấm men, Saccharomyces cerevisiae ABSTRACT Fermented fruit juice products are growing strongly in Vietnam market. The proper use of yeast strains during fermentation of juice should be considered. Isolation, selection of yeasts associated with local fruits and fermentation on mango juice have been investigated. There were 16 strains of yeast isolated from natural fermented fruit samples and two selected strains are N11 and N23. They can tolerate with glucose concentration of 25% w/v, alcohol content of 8% v/v and can form aggregates. These two strains were used to ferment mango juice, which produced fermented liquids with alcohol contents of 4,7% v/v and 4,57% v/v, respectively. The results from the sequencing of the 28S rRNA gene showed that both selected strains were Saccharomyces cerevisiae species with an identity of 99%. The selected yeasts contribute to enhance the value of products, to stabilize the quality and to promote the development of the fermented fruit drinks industry with low alcohol content. Keywords: 28S rRNA, fermented mango juice, Saccharomyces cerevisiae, yeast 1 Viện Công nghệ Sinh học và Môi trường, Trường Đại học Nha Trang 2 Trung tâm Thí nghiệm Thực hành, Trường Đại học Nha Trang THOÂNG BAÙO KHOA HOÏC I. ĐẶT VẤN ĐỀ Hệ vi sinh vật tham gia trong quá trì nh lên men trái cây tự nhiên rất phức tạp nên thường cho độ cồn không cao, dễ bị nhiễm tạp, chất lượng rượu ít được đảm bảo. Công nghiệp lên men hiện đại xây dựng dựa trên việc sử dụng chủng nấm men tuyển chọn có độ tin cậy về an toàn, khả năng lên men tốt, 10 • TRƯỜNG ĐẠI HỌC NHA TRANG Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 góp phần ổn định chất lượng của sản phẩm tạo ra [1], [6], [7]. Do đó, các chủng nấm men thuần đang được sử dụng phổ biến trong công nghiệp nước quả lên men trên thế giới [9], [13]. Các loà i và chủ ng nấm men với các đặc tính khác nhau sẽ tạo thành các chất dễ bay hơi có thành phần và tỷ lệ khác nhau trong sản phẩm lên men [14]. Nhiều nghiên cứu cho thấy, các chủng Saccharomyces cerevisiae có tính chất sinh hóa đặc trưng đã được tuyển chọn dùng để sản xuất rượu vang từ trái cây có sẵn tại địa phương với công nghệ thích ứng có thể thực hiện đơn giản, rẻ tiền [1], [4], [9]. Xoài là đối tượng sản xuất rượu vang với chất lượng tương tự rượu vang nho [6], [11]. Tuy nhiên, có rất ít thông tin về sản xuất rượu vang xoài, đặc biệt là sản xuất rượu vang phù hợp giống xoài địa phương với chủng nấm men thuần [12]. Ở Việt Nam đã có nghiên cứu sử dụng chủng nấm men bánh mỳ Saccharomyces cerevisiae (Pháp) trong quá trình lên men rượu vang xoài [2]. II. VẬ T LIỆ U VÀ PHƯƠNG PHÁP NGHIÊN CỨU 1. Thu thập mẫu trá i cây Mẫu trái cây (dâu, nho, xoài, vải, nhãn) không có các chất kích thích và chất phòng trừ sâu bệnh được thu nhận tại các nhà vườn thuộc các tỉnh Ninh Thuận, Khánh Hòa và Lâm Đồng. Các mẫu trái cây sau thu nhận được làm dập trong túi nilon vô trùng, ủ lên men tự nhiên và giữ làm nguồn phân lập nấm men. Trái cây có vỏ cứng được loại bỏ vỏ vô trùng, tránh tạp nhiễm sau đó đem làm dập. Mẫu sau 1 tuần lên men được bảo quản ở 40C để tiến hành phân lập. 2. Phân lập và làm thuần chủng nấ m men Chủng nấm men được phân lập trên môi trường YPG (YPG: yeast extract peptone glucose medium) và YPG có bổ sung 6 g/L tartaric acid, 30 mg/mL chloramphenicol. Các môi trường sử dụng trong thí nghiệm đều là môi trường của Merck (Đức). Lấy 1g mẫu trái cây lên men pha loãng, và cấy trang trên môi trường YPG, ủ ở 300C trong 24 - 48 giờ. Sau khi ủ, chọn các khuẩn lạc điển hình cấy ria sang môi trường YPG có bổ sung chloramphenicol 30 mg/l môi trường và ủ cùng điều kiện. Khi khuẩn lạc thuần phát triển tốt, cấy chuyển ống thạch nghiêng YPG và bảo quản ở 40C chuẩn bị cho nghiên cứu tiếp theo [8], [9]. 3. Tuyển chọn chủng nấm men 3.1. Thí nghiệm kiểm tra khả năng chịu nồng độ đường của chủng phân lập Chủng phân lập được thử nghiệm bằng cách nuôi cấy cùng mật độ trong các bình nuôi cấy chứa canh YPG bổ sung glucose lần lượt với các nồng độ 15%, 20%, 25%, 30% (w/v) ở 300C trong 48 giờ, đo mật độ quang OD540nm và so sánh khả năng chịu nồng độ đường thử nghiệm của chủng phân lập. Việc tăng mật độ quang học trong mỗi bình nuôi cấy được ghi nhận như bằng chứng của sự phát triển. Nồng độ của đường mà tại đó sự tăng trưởng của nấm men bị ức chế được đánh giá là khả năng chịu đựng đường của nấm men [13]. 3.2. Thí nghiệm kiểm tra khả năng chịu nồng độ cồn Chủng phân lập được thử nghiệm bằng cách nuôi cấy cùng mật độ trong các bình nuôi cấy chứa canh YPG bổ sung ethanol tinh khiết với các nồng độ tương ứng 0%, 4%, 6%, 8%, 10% (v/v) ở 300C trong 48 giờ và tương tự xác định OD540nm. Nồng độ rượu tại đó sự sinh trưởng của nấm men bị ức chế được đánh giá là khả năng chịu đựng ethanol của nấm men [5], [13]. 3.3. Thí nghiệm kiể m tra khả năng kết lắng của chủng lên men Nấm men được nuôi cấy trong ống nghiệm chứa 10ml canh YPG và ủ ở 300C trong 48 - 72 giờ. Sau khi ủ, lấy ống nghiệm ra lắc đều, đo chiều cao đoạn lắng trong ở các ống nghiệm. Nếu nấm men có khả năng lắng tốt thì 7 ngày sau khi lên men, chiều cao đoạn dịch trong >75 % chiều cao của khối môi trường lên men. Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 TRƯỜNG ĐẠI HỌC NHA TRANG • 11 Nếu chiều cao đoạn dịch trong chiếm 50 - 75% chiều cao của khối môi trường lên men, cho biết nấm men có khả năng lắng trung bình, chiều dài đoạn dịch trong chiếm 25 - 50% chiều cao của khối môi trường lên men cho biết nấm men có khả năng lắng yếu, nếu chiều dài đoạn dịch trong <25% chiều cao của khối môi trường lên men, thì nấm men không lắng [3], [8]. 3.4. Thí nghiệm kiểm tra khả năng chuyển hóa đường và lên men tạo cồn trong dịch xoài Dịch xoài được điều chỉnh nồng độ chất rắn hòa tan 20oBrix bằng saccharose, pH 3,5 và thanh trùng ở 700C/5 phút. Chủng tuyển chọn được đưa vào nuôi cấy với mật độ chủng giống ban đầu 106 cfu/ml và lên men kín ở 250C trong 5 ngày. Xác định hàm lượng chất rắn hòa tan còn lại trong dịch lên men và nồng độ cồn tạo ra [5]. 3.5. Định danh chủng tuyển chọn Chủng sau khi tuyển chọn, làm thuần được gửi định danh tại Phòng xét nghiệm NK- BIOTEK thuộc Công ty Nam Khoa, thành phố Hồ Chí Minh thực hiện. Quá trình định danh dựa trên gen 28S rRNA và sử dụ ng công cụ Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi) để so sá nh vớ i cá c trì nh tự có sẵ n trên Ngân hà ng gen thế giớ i (Genbank). 4. Xử lý số liệu Các thí nghiệm trên được lặp lại 3 lần và số liệu được xử lý trên phần mềm Exel, phân tích thống kê ANOVA (p<0,05) xác định ý nghĩa của sự khác biệt của mỗi yếu tố. III. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 1. Kết quả phân lập nấm men từ một số dịch ép trái cây Qua nhiều lần phân lập trên môi trường YPG có bổ sung kháng sinh và acid tartaric, nghiên cứu đã thu được 16 chủng nấm men thuần. Các chủng phân lập được trên môi trường thạch YPG ở 300C sau 24 giờ có hình dạng khuẩn lạc màu trắng sữa hoặc trắng trong, bề mặt nhẵn hoặc hơi lồi, kích thước 0,5 - 1,5 mm. Khi khuẩn lạc phát triển thuần khiết, chủng được cấy chuyển sang ống thạch nghiêng YPG và bảo quản ở 40C chuẩn bị cho thí nghiệm tiếp theo. Kết quả quan sát tế bào nhuộm đơn cho thấy, các tế bào nấm men phân lập được có kích thước lớn, hình dạng từ hơi dài đến ô van bầu dục hoặc hình cầu. Các chủng phân lập sinh sản theo hình thức nảy chồi hoặc sinh bào tử. Trong 16 dòng nấm men quan sát được có 5 chủng hình cầu hoặc bầu dục và 9 chủng hình elip dài, 2 chủng phân nhánh. Như vậy, các chủng nấm men được phân lập từ trái cây lên men có sự đa dạng về hình dạng tế bào. Một số hình dạng tế bào nấm men phân lập được thể hiện trên Hình 1. (1) (2) (3) Hình 1. Hình dạng tế bào nấm men N11, N23, V11 (1) Hình dạng tế bào N11; (2) Hình dạng tế bào N23; (3) Hình dạng tế bào V11 12 • TRƯỜNG ĐẠI HỌC NHA TRANG Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 2. Kết quả tuyển chọn chủng nấm men 2.1. Kết quả thí nghiệm kiểm tra khả năng chịu nồng độ đường của chủng phân lập Kết quả đo OD540nm sau nuôi cấy củ a 7 chủng phân lập có khả năng chịu nồng độ đường >20% trên môi trường YPG có bổ sung lần lượt 15, 20, 25, 30% (w/v) glucose so với môi trường YPG chuẩn đối chứng được thể hiện trên Bảng 2. Số lượng chủng nấm men phân lập được từ các mẫu trái cây lên men và kí hiệu chủng được ghi nhận trong Bảng 1. Bảng 1. Các chủng nấm men phân lập được từ mẫu trái cây lên men Mẫu phân lập Số lượng Kí hiệu chủng Dịch nho lên men (3 ngày) 5 N11, N12, N13, N14, N15 Dịch xoài lên men 2 X11, X12 Dịch dâu lên men 4 D11, D12, D13, D14 Dịch nho lên men (1tháng) 2 N22, N23 Dịch vải lên men 3 V11, V12, V13 Bảng 2. Ảnh hường của nồng độ đường đến sinh trưởng của 7 chủng phân lập Chủng tuyển chọn Hàm lượng đường % (w/v) Đối chứng 15 20 25 30 N11 1,76 ± 0,04a 1,87 ± 0,09a 1,79± 0,07a 1,72 ± 0,04a 0,75 ± 0.,24b N14 1,74± 0,07a 1,85 ± 0,08a 1,75 ± 0,13a 0,52 ± 0,12a 0,27 ± 0,05b D11 1,74 ± 0,06a 1,68 ± 0,02a 1,61 ± 0,8a 0,32 ± 0,03b 0,22 ± 0,08b N22 1,79 ± 0,07a 1,87± 0,09a 1,79 ± 0,11a 1,81 ± 0,06a 0,24 ± 0,03b N23 1,8 ± 0,06a 1,85 ± 0,09a 1,85 ± 0,05a 1,83± 0,05a 1,51 ± 0,05a V11 1,86 ± 0,1a 1,81 ± 0,05a 1,79 ±0,04a 1,72± 0,05a 0,55 ± 0,21b V13 1,73 ± 0,07a 1,83 ± 0,01a 1,77 ± 0,04a 0,62 ± 0,29b 0,22 ± 0,04b Các giá trị a, b thể hiện sự khác biệt có ý nghĩa giữa các số liệu (p<0,05) Từ Bảng 2 cho thấy, 4 chủng có khả năng chịu được nồng độ glucose 25%(w/v), trong khi đó ở nồng độ glucose 30% (w/v) chỉ có duy nhất một chủng phát triển. Kết quả đánh giá được phân tích trên phần mềm SPSS xác định sự khác biệt giữa giá trị OD540nm của các chủng nuôi cấy trong môi trường đối chứng và nuôi cấy ở các nồng độ chất rắn hòa tan khác nhau với độ tin cậy 95%. Theo một số nghiên cứu, nồng độ chất rắn hòa tan trong dịch trái cây lên men thường trong khoảng 18 - 22 0Brix [6], [11]. Như vậy, 7 chủng N11, N14, D11, N22, N23, V11, V13 có khả năng phát triển ở nồng độ đường >20% có sự khác biệt không có ý nghĩa với mẫu đối chứng (p>0,05) nên được tuyển chọn cho nghiên cứu tiếp theo. 2.2. Kết quả thí nghiệm kiểm tra khả năng chịu nồng độ cồn của chủng phân lập Khảo sát trên 7 chủng tuyển chọn cho thấy, khi nuôi cấy trong môi trường chứa nồng độ cồn 4% có 6 chủng, ở nồng độ cồn 6% có 5 chủng, ở nồng độ cồn 8% chỉ có 3 chủng có độ OD540nm không khác biệt có ý nghĩa với mẫu đối chứng (p>0,05). Kết quả thí nghiệm kiểm tra khả năng chịu nồng độ cồn của 3 chủng phân lập chịu nồng độ cồn 8% được thể hiện trong Bảng 3. Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 TRƯỜNG ĐẠI HỌC NHA TRANG • 13 Kết quả phân lập chủng nấm men từ bánh men rượu [3], [8], [9] cho 30 chủng phân lập có khả năng chịu cồn tới 17%, trong khi đó thí nghiệm chỉ phân lập được 3 chủng có khả năng chịu cồn đến 8%. Điều đó cho thấy rằng các chủng nấm men phân lập từ trái cây lên men có khả năng chịu cồn thấp hơn so với các chủng phân lập từ bánh men rượu. Tuy nhiên kết quả nghiên cứu phù hợp với một số tác giả cho rằng đa số nấm men tự nhiên trên bề mặt quả bị ức chế ở nồng độ cồn 1 - 3% [5], [10], [15]. Nghiên cứu tiếp tục thực hiện quá trình tuyển chọn với 3 chủng N11, N23 và V11 có khả năng chịu nồng độ cồn 8% (v/v). 2.3. Kết quả xác định khả năng kết lắng của chủng tuyển chọn Kết quả xác đinh khả năng lắng của chủng tuyển chọn thể hiện trong Bảng 4. Bảng 3. Ảnh hưởng của nồng độ cồn đến sinh trưởng của 3 chủng chịu nồng độ cồn 8% (v/v) Chủng tuyển chọn Nồng độ cồn % (v/v) Đối chứng 4% 6% 8% 10% N11 1,79 ± 0,09a 1,75 ± 0,14a 1,71 ± 0,06a 1,05 ± 0,05ab 0,27± 0,05b N23 1,75 ± 0,03a 1,73 ± 0,07a 1,60 ± 0,15a 1,20 ± 0,07ab 0,7 ± 0,64b V11 1,78 ± 0,07a 1,75 ± 0,14a 1,74 ± 0,03a 1,03 ±0,6ab 0,53 ± 0,23b Các giá trị a, b thể hiện sự khác biệt có ý nghĩa giữa các số liệu (p<0,05) Bảng 4. Khả năng kết lắng của chủng tuyển chọn Chủng tuyển chọn Dạng kết lắng Độ cao phần dịch trong so với toàn ống nuôi cấy (%) N11 dạng bột > 75 % N23 dạng bột > 75 % V11 dạng bột 50 % - 75 % Kết quả khảo sát cho thấy 2 chủng N11 và N23 có khả năng kết lắng tốt, dịch lên men trong độ cao lớn 75% chiều cao của dịch lên men sau 7 ngày lên men. Kết lắng dạng bột bám chắc đáy ống lên men, thuận tiện quá trình tách cặn sau lên men. Khả năng kết lắng là một đặc tính rất tốt dùng để sản xuất rượu vang, vì nấm men kết lắng tốt thuộc nhóm nấm men lên men chìm, nhóm nấm men lên men chậm, nên khả năng giữ mùi hương cao, kết lắng tốt làm cho rượu trong, quá trình lắng sẽ không tốn các phụ gia cũng như thiết bị lọc. Mặt khác nếu nấm men thuộc nhóm nấm men lên men bề mặt, hoạt lực lên men mạnh, CO2 sinh ra nhiều sẽ mang theo các chất thơm, làm mất mùi thơm của rượu, cho nên trong sản xuất rượu vang người ta ít sử dụng nấm men thuộc nhóm lên men bề mặt [8], [14]. 2.4. Kết quả thí nghiệm kiểm tra khả năng lên men rượu của chủng tuyển chọn trong dịch ép xoài Kết quả xác định hàm lượng chất rắn hòa tan còn lại (TSS) và hàm lượng cồn tạo thành sau lên men dịch xoài với chủng tuyển chọn được thể hiện trên Bảng 5. Bảng 5. Khả năng lên men rượu của chủng tuyển chọn trong dịch ép xoài Chủng tuyển chọn Hàm lượng TSS ban đầu (oBrix) Hàm lượng TSS còn lại (oBrix) Hàm lượng cồn tạo thành (% v/v) N11 16,2 7,10± 0,36a 4,70 ± 0,1bb N23 16,2 7,57 ± 0,51a 4,57 ± 0,21b Các giá trị a, b thể hiện sự khác biệt có ý nghĩa giữa các số liệu (p<0.05) 14 • TRƯỜNG ĐẠI HỌC NHA TRANG Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 Theo kết quả thể hiện trên Bảng 5, các chủng N11 và N23 đều có khả năng chuyển hóa đường tốt để tạo thành cồn. Hiệu suất chuyển hóa đường tương ứng đạt 56,2% và 53,3%. So với các nghiên cứu khác về chủng giống nấm men lên men rượu vang, khả năng chuyển hóa đường của chủng phân lập ở mức độ trung bình [6], [15]. Nồng độ cồn tạo ra trong khoảng 4,5 - 5% (v/v) phù hợp với các dòng sản phẩm nước trái cây lên men. Kết quả không có sự khác biệt có ý nghĩa giữa hàm lượng chất rắn còn lại và nồng độ cồn tạo ra giữa 2 chủng tuyển chọn với độ tin cậy 95%. 2.5. Kết quả định danh chủng tuyển chọn Kết quả giải trình tự gen chủng N11 và kết quả kiểm tra theo Blast thể hiện trên Bảng 6 và Bảng 7. Bảng 6. Trình tự gen 28S rRNA củ a chủng N11 CTCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGAACGGCCCCAAAGTTGCCCTCTC CAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTT GGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTACTCCTACCTGATTTGAGGTCAAACTTTAAGAACATTGTT CGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACC GTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTC CAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAA TGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAA CCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAAAT AAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGT TGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAG CAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAA CAAAAAAATCCATTTTCAAAATTATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTAGTTCCTC TAAATGACCAAGTTTGTCCAATTCTCCGCTCTGAGATGGAGTTGCCCCCTTCTCTAAGCAGATCCTGAGGCCTCACTAAGCCATCAAT Bảng 7. So sá nh độ tương đồ ng trì nh tự gen 28S rRNS của chủng N11 vớ i cá c chủ ng gầ n nhấ t trên Genbank Tên chủ ng Điể m tố i đa Điể m tổ ng số Độ che phủ Mứ c ý nghĩ a Độ tương đồ ng Mã hiệ u gen Saccharomyces cerevisiae YJM681 2089 1.505e+05 100% 0.0 99% CP006454.1 Saccharomyces cerevisiae YJM1573 2089 1.280e+05 100% 0.0 99% CP006431.1 Kết quả giải trình tự gen chủng N23 và kết quả kiểm tra theo Blast thể hiện trên Bảng 8 và 9. Bảng 8. Trình tự gen 28S rRNA của chủng N23 TCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGAACGGCCCCAAAGTTGCCCTCTC CAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTG GTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGTACTCCTACCTGATTTGAGGTCAAACTTTAAGAACATTGTTCGCCTAGAC GCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCAT TATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAG TATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGC GTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATC CGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAAATAAAATTGTTTGT GTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACG GTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCG CACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAAATC CATTTTTCAAAATTATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTAGTTCCTCTAAATGAC CAAGTTTGTCCAAATTCTCCGCTCTGAGATGGAGTTGCCCCCTTCTCTAAGCAGATCCTGAGGCCTCACTAAGCCATC Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 TRƯỜNG ĐẠI HỌC NHA TRANG • 15 Hình dạng khuẩn lạc N11 và N23 phân lập trên môi trường YPG và hình dạng tế bào của chúng được quan sát trên vật kính x40 của kính hiển vi được thể hiện trên Hình 2. Bảng 9. So sá nh độ tương đồ ng trì nh tự gen 28S rRNS của chủng N23 vớ i cá c chủ ng gầ n nhấ t trên Genbank Tên chủ ng Điể m tố i đa Điể m tổ ng số Độ che phủ Mứ c ý nghĩ a Độ tương đồ ng Mã hiệ u gen Saccharomyces cerevisiae YJM1592 2078 1.788e+05 99% 0.0 99% CP006433.1 Saccharomyces cerevisiae YJM1389 2078 1.517e+05 99% 0.0 99% CP006437.1 (a) (b) (c) (d) Hình 2. Hình dạng khuẩn lạc (a) và tế bào nấm men (b) của chủng N11 Hình dạng khuẩn lạc (c) và tế bào nấm men (d) của chủng N23 Kế t quả từ Bả ng 6, Bảng 7, Hì nh 2 cho thấ y trình tự gen 28S rRNA củ a chủng tuyển chọn N11 có độ tương đồng 99% vớ i chủ ng Saccharomyces cerevisiae YJM681 và YJM1573; từ Bảng 8, Bảng 9 cho thấy chủng N23 có độ tương đồng 99% với chủng Saccharomyces cerevisiae YJM1592 và YJM1389. Trong đó, N11 là chủng có nguồn gốc phân lập từ mẫu nho sau 3 ngày và N23 là chủng phân lập từ mẫu nho lên men 1 tháng. Trong mẫu rượu nho lên men 1 tháng nồng độ rượu đã tích lũy đủ lớn để ức chế nấm men tạp phát triển, chỉ chọn lọc chủng có khả năng chịu nồng độ cồn tồn tại. Điều này phù hợp với nhiều nghiên cứu cho rằng, chủng Saccharomyces cerevisiae có khả năng chịu cồn và thường xuất hiện với mật độ lớn ở cuối quá trình lên men [7], [8]. Các chủng nấm men Saccharomyces cerevisiae đã được nhiều nghiên cứu sử dụng làm giống khởi động trong lên men rượu trái cây cho sản phẩm đạt chất lượng cao, hiệu suất sản xuất tốt [4], [8], [14]. IV. KẾT LUẬN Tổ ng số 16 chủng nấm men đã được phân lập từ các mẫu trái cây lên men tự nhiên. Kế t quả tuyển chọn 2 chủng N11 và N23 có nguồn gốc từ quả nho lên men tự nhiên có khả năng chịu được nồng độ đường 25% (w/v) và nồng độ rượu 8% (v/v). Các chủng này có khả năng kết lắng tốt >75%, và có khả năng lên men dịch xoài với hiệu suất chuyển hóa đường 56%, độ rượu tạo thành >4,5%. Kết quả định danh cho thấy chủng N11 và N23 có độ tương đồng 99% với chủng Saccharomyces cerevisiae xác định theo Blast. TÀI LIỆU THAM KHẢO Tiếng Việt 1. Ngô Thị Phương Dung, Lý Huỳnh Liên Hương và Huỳnh Xuân Phong, 2011. Phân lập, tuyển chọn nấm men và xác định điều kiện ảnh hưởng quy trình lên men rượu vang dưa hấu. Tạp chí Khoa học, Trường Đại học Cần Thơ 2011:18b, 137-145. 16 • TRƯỜNG ĐẠI HỌC NHA TRANG Tạp chí Khoa học - Công nghệ Thủy sản Số 3/2017 2. Nguyễn Nhật Minh Phương, Chế Văn Hoàng, Lý Nguyễn Bình, Châu Trần Diễm Ái, 2011. Tác động enzyme pectinase đến khả năng trích ly dịch quả và các điều kiện lên men đến chất lượng rượu vang xoài sau thời gian lên men chính. Tạp chí Khoa học Trường Đại học Cần Thơ 2011:20a, 127-136. 3. Nguyễn Hữu Thanh, Nguyễn Thị Kỳ Duyên, Bằng Hồng Lam, Nguyễn Quang Thạch, 2012. Khảo sát một số đặc tính sinh học và định danh nấm men được phân lập từ nấm men rượu ở đồng bằng sông Cửu Long. Tạp chí Khoa học và Phát triển, Trường Đại học Nông nghiệp Hà Nội Tập 10, số 2, 340-349. 4. Nguyễn Thế Trang, 2007. Nghiên cứu khả năng lên men rượu của các chủng nấm men Saccharomyces cerevisiae trên môi trường dịch chiết quả me rừng (Phyllanthus emblyca L). Tạp chí Nông nghiệp và Phát triển Nông thôn, 12 +13, 113-115. Tiếng Anh 5. Casey G. P., Ingledew W. M, 1986. Ethanol tolerance in yeast. CRC Critical Reviews in Microbiology, 13(3): 219-280. 6. Czyhrinciwk N., 1966. The technology of passion fruit and mango wines. American Journal of Enology and Viticulture, 17: 27-30. 7. Fleet G.H., 2003. Yeasts in fruit and fruit products. In: Boekhout T., Robert R., Yeasts and Food. Benefi cial and Detrimental Aspects BehrsVerlag: 267-288. 8. Guimarães T. M., G. Moriel G. D., Machado I.P., Cyntia M.T., Fadel P., Tania M. , Bonfi m B., 2006. Isolation and characterization of Saccharomyces cerevisiae strains of winery interest. Brazilian Journal of Pharmaceutical Sciences vol. 42. n.1. 9. Maragatham C., Panneerselvam A., 2011. Isolation, identifi cation and characterization of wine yeast from rotten papaya fruits for wine production. Advances in Applied Science Research, 2 (2): 93-98. 10. OanaA. A., Vasile A., Katsutada T., Fumiki Y., 1997. Quantitative Study of Yeast Growth in the Presence of Added Ethanol and Methanol Using a Calorimetric Approach, Bioscientist Biotechnology. Biochemistry, 61 (4): 664-669. 11. Reddy L. V. A., Reddy O. V. S., 2005. Production and Characterization of Wine from Mango Fruit (Mangifera indica L). World Journal of Microbiology and Biotechnology,Volume 21, Issue 8 : 1345-1350 12. Reddy L. V. A., Reddy O. V. S, 2009. Production, optimization and characterization of wine from Mango (Mangiferaindica Linn.). Indian Journal of Natural Products and Resources (IJNPR), Vol. 8(4): 426-435. 13. Tahía B., Lucas DEL C., Andrés A., Jaime C., and E. Cerdáo l. E., 2011. Selection of Wine Yeasts for Growth and Fermentation in the Presence of Ethanol and Sucrose Mycobiology, 39(1): 33–39. 14. Xu Li, Yu B., Curran P., Liu S.-Q, 2011. Chemical and volatile Composition of Mango wines fermented with different Saccharomyces cerevisiae yeast strains. South African Journal of Enology and Viticulture, Vol. 32 Issue 1, p117: 1353-1360. 15. Yeon-Ju K, Lee, Yu-Ri C., So-Young L., Jong-Tae P., Jae-Hoon S., Kwan-Hwa P., and Jung-Wan K., 2011. Screening wild yeast strains for alcohol fermentation from various fruits. Mycobiology 39(1): 33-39.

Các file đính kèm theo tài liệu này:

  • pdfphan_lap_tuyen_chon_nam_men_tu_trai_cay_dia_phuong_va_thu_ng.pdf
Tài liệu liên quan