Mối quan hệ giữa gen hormone sinh trưởng với tăng khối lượng ở lợn Móng Cái lai

Kết quả so sánh ANOVA một yếu tố cho thấy sự khác nhau có ý nghĩa thống kê về tính trạng TKL giữa 3 kiểu gen C2C2, C2C4, C4C4 của lợn Y, MCTH và MC lai: F1(YxMCTH), F2(YxMCTH) với mức ý nghĩa p<0,05: Lợn mang kiểu gen C2C2 có TKL cao nhất, kiểu gen C2C4 có TKL trung bình và kiểu gen C4C4 có TKL thấp nhất. Với phép kiểm tra t’, sử dụng đường cong phân bố chuẩn 2 chiều cho thấy, ở lợn MCTH không phát hiện được sự khác nhau có ý nghĩa thống kê về TKL trung bình giữa nhóm mang và không mang allele C2. Nhưng ở các cá thể lợn F1 và F2 mang allele C2 (C2C2 và C2C4) và không mang allele C2 (C4C4) lại có sự TKL khác nhau với mức độ tin cậy  = 0,025.

pdf8 trang | Chia sẻ: truongthinh92 | Lượt xem: 1519 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Mối quan hệ giữa gen hormone sinh trưởng với tăng khối lượng ở lợn Móng Cái lai, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn 73 MỐI QUAN HỆ GIỮA GEN HORMONE SINH TRƯỞNG VỚI TĂNG KHỐI LƯỢNG Ở LỢN MÓNG CÁI LAI Nguyễn Vân Anh1*, Nguyễn Văn Cường2 và Nguyễn Văn Đức3 1Đại học Sư phạm Thái Nguyên 2Viện Công nghệ Sinh học – Viện Khoa học và Công nghệ Việt Nam 3Viện Chăn nuôi, Bộ Nông nghiệp và PTNT *Tác giả liên hệ: Nguyễn Vân Anh - Đại học Sư phạm Thái Nguyên Tel: 0983.140.875 ; Email: nvananh1979@ gmail.com ABSTRACT Relationship between growth hormone gene and average daily gain of Mong Cai crossbred pigs The indigenous pig breed of Mong Cai (MC) has the high reproductive performance, but their growth rate is limited. The average daily gain (ADG) of Y pigs was 816.6614.34g/day, ADG of MC was 407,409,86g/day, while ADG of F1(YxMC) was 665,7429,83g/day and ADG of F2(YxMC) was 670,8331,45g/day. The role of growth hormone (GH) gene on performance traits such as growth rate (GR) has been confirmed in some pig breeds. Higher exogenous porcine GH concentration causes higher muscle mass and improves feed conversion rate (FCR) and ADG. In this paper, genetic variation of GH in MC pigs was studied using PCR- RFLP and association of their genotypes and ADG trait. Specific primer pairs, 605 bp DNA fragments of GH have been amplified. Digestion of GH with HhaI revealed point mutation at two position of +329 and +378. Genotype frequencies were 16.96%, 50.90% and 32.14% for C2C2, C2C4 and C4C4, respectively. Relationship between genotypes and ADG has been analyzed by using t’-test in MC crossbred pigs. The result showed there was no significance in ADG between animals carrying C2 allele (C2C2 and C2C4 genotype) and that no C2 allele (C4C4 genotype) was found in MCTH pigs. However, a significant difference between animals carrying C2 allele (C2C2 and C2C4 genotype) and animals without C2 allele (C4C4 genotype) in F2 (YxMC) and (YxMC) was observed (with  = 0,025). Keywords: MC crossbreds, relationship between ADG and GH, GH gene, ADG ĐẶT VẤN ĐỀ Lợn Móng Cái (MC) là giống lợn nội được nuôi phổ biến nhất vùng đồng bằng Bắc Bộ nhờ những đặc tính tốt như: dễ nuôi, thành thục sớm, mắn đẻ, khả năng chống chịu bệnh cao, chủ yếu được sử dụng làm nái nền, lai với lợn đực nhập nội cao sản Landrace, Yorkshire (Y), Large White, Duroc, Piétrain... tạo các tổ hợp lai nuôi thịt nhằm nâng cao hiệu quả, góp phần đưa năng xuất, chất lượng đàn lợn nước ta ngày một tăng lên. Song, tăng khối lượng (TKL) của lợn MC rất thấp, chỉ biến động trong phạm vi 333-380 g/ngày, ngoại trừ nhóm lợn MC cao sản MC15 và lợn MC tổng hợp (MCTH) mới được tạo chọn ra cũng chỉ đạt tới 400-410 g/ngày. Vì vậy, việc nghiên cứu xác định kiểu gen tác động đến khả năng sinh trưởng để giúp cho chọn lọc nhằm tăng nhanh TKL là một yêu cầu rất cấp thiết trong ngành chăn nuôi lợn ở nước ta, nhất là đối với giống MC. Các ứng cử gen liên quan đến tính trạng sinh trưởng và sản lượng thịt ở lợn đã được tiến hành nghiên cứu khá phong phú trên thế giới như hormone sinh trưởng (GH) bởi Knorr và cs (1997), Pierzchala và cs (2004); Artur và cs (2007); PIT1 bởi Yu và cs (1995); Franco và cs (2005), IGF-1 bởi Casas-Carrillo và cs (1997), Leptin (LEP) bởi Hardge (1998); Urban và cs (2002). Gen GH định vị ở vai ngắn (p1.2  p1.5) của nhiễm sắc thể số 12 ở lợn (Yerle và cs, 1993), bao gồm 5 exon với tổng chiều dài phiên mã là 1,7kb (Vize và Wells, 1997). Kết quả nghiên VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 74 cứu của Nielsen và cs (1995) gợi ý rằng sự khác nhau trong hoạt tính sao chép giữa các biến thể gen GH làm cho hàm lượng GH trong huyết thanh cao hơn và tăng khối lượng lớn hơn. Mối tương quan giữa kiểu gen GH với một số tính trạng kinh tế như: độ dày mỡ lưng, tỷ lệ nạc và khả năng tăng khối lượng đã được xác nhận ở thế hệ con lai giữa lợn Meishan và Piétrain (Knorr và cs, 1997), lợn Duroc, Yorkshire, TaoYoan (Cheng và cs, 2000). Nhiều nghiên cứu về đa hình gen liên quan đến tính trạng tăng khối lượng (TKL) ở các giống lợn đã được tiến hành ở Việt Nam như Đa hình di truyền gen Hormone sinh trưởng (GH) ở giống lợn MC (Nguyễn Thị Diệu Thúy và cs, 2004), đa hình di truyền gen Myogenin ở lợn giống MC (Nguyễn Vân Anh và cs, 2005). Để được góp phần vào việc xác định mối tương quan di truyền giữa kiểu gen GH với tính trạng TKL ở lợn đực giống Yorkshire (Y), lợn nái giống MCTH và nhóm lợn MC lai (F1 và F2), chúng tôi tiến hành đề tài “Xác định mối quan hệ giữa kiểu gen Hormone sinh trưởng với tính trạng tăng khối lượng ở lợn Móng Cái lai”. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Vật liệu nghiên cứu Bảng 1. Sơ đồ đàn lợn thí nghiệm Lợn giống Lợn vỗ béo Thế hệ Lợn đực Lợn nái Lợn đực Lợn cái Tổng (Con) F0 1 Y 6 MCTH 2 Y, 6 MCTH 2 Y, 6 MCTH 23 F1 1 F1(Yx MCTH) 12 F1(Yx MCTH) 12 F1(Yx MCTH) 12 F1(Yx MCTH) 37 F2 36 F2(Yx MCTH) 36 F2(Yx MCTH) 72 ∑ 2 18 56 56 132 Tổng số 132 lợn thí nghiệm (Bảng 1), trong đó: đàn lợn tham gia tạo giống gồm 1 đực giống Yorkshine (Y), 6 nái MCTH, 1 đực giống F1(Yx MCTH), 12 nái F1(Yx MCTH) và đàn lợn vỗ béo là 112 con, gồm 4 Y, 12 MCTH, 24 F1(Yx MCTH) và 72 F2(YxMCTH) với tỷ lệ đực cái là 50/50. Lợn thí nghiệm được tạo ra và nuôi dưỡng theo đúng các qui trình chăn nuôi lợn giống đực Y, nái MC và lợn vỗ béo Y, MCTH và lợn lai (ngoại x nội) F1(Yx MCTH), F2(Yx MCTH) theo quy trình nuôi vỗ béo tại các nông hộ thuộc các gia trại nuôi lợn của ông Lê Mạnh Quý ở Huyện Bảo Thắng, tỉnh Lào Cai. Phương pháp nghiên cứu Sơ đồ tạo lợn thí nghiệm: 1 đực Y phối với 6 nái MCTH tạo đàn F1(YxMCTH). Chọn 1 đực F1(YxMCTH) phối với 12 nái F1(YxMCTH) để tạo đàn F2(YxMCTH). Tính trạng sản xuất về TKL được xác định bằng cách cân lợn lúc bắt đầu vào vố béo (75 ngày tuổi) và kết thúc vỗ béo. Thời gian vỗ béo là 90 ngày. Mẫu mô tai của các giống lợn được thu thập từ tháng 5/2007 đến tháng 5/2009. Mẫu được bảo quản trong cồn 750 ở các lọ lấy mẫu. Mẫu được bảo quản ở -200C và sau đó được sử dụng để phân tích các gen. ADN hệ gen được tách từ mô qua bước thủy phân bằng Proteinase - K, làm sạch bằng Phenol, chloroform và tủa cồn (Asubel và cs, 1995). PCR được tiến hành với tổng thể tích 25 µl, bao NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn 75 gồm: 100 ng ADN tổng số; 10pM mồi xuôi và ngược; 0,2mM dNTP; 1,5mM MgCl2; 1U Taq polymerase và đệm PCR 10x. Trình tự mồi và độ lớn sản phẩm PCR trình bày ở Bảng 2. Bảng 2. Trình tự mồi và độ lớn sản phẩm PCR Tên mồi Trình tự mồi* Độ lớn sản phẩm PCR (bp) GH F: 5’-TTATCCATTAGCAACTGCCTGCCAG - 3’ R: 5’- CTGGGGAGCTTACAAACTCCTT - 3’ 605 *F: Mồi xuôi; R: Mồi ngược Chu trình nhiệt phản ứng PCR Gồm các giai đoạn Biến tính toàn bộ 940C trong 3 phút, phản ứng lặp lại 35 chu kỳ các bước: biến tính cục bộ 940C trong 45 giây, bám mồi 620C trong 1 phút; tổng hợp ở 720C trong 1 phút; hoàn thành phản ứng tổng hợp ở 720C trong 10 phút và giữ mẫu ở 40C. Phản ứng cắt sản phẩm PCR-GH bằng enzyme hạn chế HhaI gồm các thành phần sau: 2,5µl đệm cắt, 20µl sản phẩm PCR, 1µl (10U) enzyme cắt và 1,5µl H2O. Hỗn hợp được ủ qua đêm ở 370C. Kết quả PCR và sản phẩm cắt enzyme hạn chế được kiểm tra trên gel agarosse 2%, nhuộm bằng Ethidium Bromide và phát hiện dưới ánh sáng UV. Xử lý số liệu Số trung bình bình phương nhỏ nhất (LSM) và Sai số chuẩn (SE) theo SAS (1993). Ưu thế lai được xác định theo công thức của Falconer và Mackay (1996). So sánh mức độ sai khác giữa các số trung bình được xác định theo phương pháp Kiểm tra mức độ tin cậy số trung bình mẫu (t) của Nguyễn Văn Đức và Lê Thanh Hải (2002). KẾT QUẢ VÀ THÁO LUẬN Tăng khối lượng của lợn Tăng khối lượng (TKL) của đàn lợn thí nghiệm tại Bảo Thắng, Lào Cai được xác định là cao: Cao nhất là giống lợn Yorkshire (816,6614,34 g/ngày và thấp nhất ở lợn MCTH, nhưng cũng đã đạt tới 407,409,86 g/ngày. Trong lúc đó, hai nhóm lợn MC lai F1(YxMCTH) là 665,7429,83 g/ngày và F2(YxMCTH) là 670,8331,45g/ngày. Sự sai khác về TKL giữa các nhóm lợn có ý nghĩa thống kê rõ rệt, ngoại trừ giữa hai nhóm lợn MC lai F1(YxMCTH) và F2(YxMCTH) (p>0,05). Đối với nhóm lợn MCTH, TKL ở nghiên cứu này cao hơn kết quả công bố của Nguyễn Văn Đức và cs (2007); Giang Hồng Tuyến và cs (2006); Giang Hồng Tuyến (2008); Giang Hồng Tuyến và cs (2008) trên nhóm lợn MC15 và MCTH nuôi tại Hải Phòng và Lào Cai (Nguyễn Văn Đức và cs, 2009). Đối với giống lợn Y và nhóm lợn MC lai, TKL trong nghiên cứu này cao hơn kết quả công bố của Nguyễn Văn Đức (1997); Nguyễn Văn Đức (1999); Nguyễn Văn Đức (2001); Nguyễn Văn Đức và cs (2001) trên giống lợn Y, MC, MC lai F1(LRxMC) và F1(YxMC), đồng thời cao hơn nhóm lợn lai F1(PixMC) nuôi tại Đông Anh, Hà Nội (Trần Thị Minh Hoàng và cs, 2003). Kết quả này thấp hơn so với lợn lai Dx(YMC) và Lx(YMC) là 673,60 và 679,48 g/ngày (Đặng Vũ Bình và cs, 2008). VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 76 Phân tích PCR-RFLP gen GH bằng enzyme HhaI Kết quả nhân đoạn gen GH bằng PCR được trình bày ở hình 1. Sản phẩm PCR là một băng rõ nét, có kích thước tương ứng là 605 bp đã được nhân đặc hiệu. Hình 1. Sản phẩm PCR đoạn gen GH M: Thang ADN chuẩn 100 bp 1-5: Sản phẩm PCR Hình 2. Kết quả cắt đoạn gen GH bằng HhaI M: Thang ADN chuẩn 100 bp 1,7: Kiểu gen C4C4; 2,3,4: Kiểu gen C2C4; 5,6,8: Kiểu gen C2C2 Sản phẩm PCR của đoạn gen GH được cắt bởi enzyme HhaI. Vị trí cắt của enzyme cắt, độ dài đoạn cắt được trình bày ở Bảng 3. Đoạn gen GH này chứa 2 điểm đột biến tại vị trí +329 và +378, vì thế khi HhaI cắt tại các vị trí trên sẽ tạo ra các đoạn ADN có kích thước phân tử tương ứng 49, 107, 156, 449, 498 bp. Trường hợp không có đột biến nào tại 2 vị trí trên thì đoạn ADN sẽ không bị cắt nên sản phẩm cắt sẽ là đoạn ADN có kích thước 605 bp. Bảng 3. Điểm cắt của enzyme cắt hạn chế và độ dài đoạn cắt gen GH Allele Vị trí cắt Số điểm cắt Độ dài đoạn cắt (bp) C1 - 0 605 C2 +378 1 498/107 C3 +329 1 449/156 C4 +378, +329 2 449/107/49 Đoạn gen GH bị cắt bởi HhaI tạo ra 4 dạng alen C1, C2, C3, C4. Như vậy, tổ hợp của chúng sẽ có 10 kiểu gen như: C1C1, C2C2, C3C3, C4C4, C1C2, C1C3, C1C4, C2C3, C2C4, C3C4. Ảnh điện di (hình 2) cho thấy, các đoạn ADN có kích thước khác nhau phù hợp với tính toán lý thuyết. Cả 3 dạng kiểu gen xuất hiện với tần số khác nhau trong các mẫu nghiên cứu. Trong nghiên cứu này, gen GH ở giống lợn Y, MCTH và MC lai chỉ xuất hiện 2 dạng alen C2 và C4, đồng thời tạo ra 3 tổ hợp kiểu gen C2C2, C2C4 và C4C4 với tần số lần lượt là 16,96%; 50,90%; 32,14%. Kết quả này của chúng tôi phù hợp với kết quả khảo sát tần số alen của gen GH ở lợn MC trong nghiên cứu trước đây của Nguyễn Thị Diệu Thúy và cộng sự (2004), trong đó kiểu gen C2C2 chiếm tỷ lệ thấp nhất, chỉ có 11% và cao nhất là C2C4, với 51%. M 1 2 3 4 5 500 605 600 1 2 3 4 5 6 7 8 M 449 107 49 498 500 100 300 NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn 77 Trong khi đó, kiểu alen C1 và C3 lại xuất hiện ở các nhóm lợn Wild Boar x Piétrain với tỷ lệ kiểu gen C2C4, C3C4 và C4C4 tương ứng là 0,34%; 28,42% và 68,84%; còn ở lợn lai Meishan x Piétrain có kiểu gen là C1C4, C2C4, C3C4 và C4C4 tương ứng là 15,49%; 29,36%; 5,48% và 15,8% (Knorr và cs, 1997). Bảng 4. Tần số kiểu gen của gen GH trên đàn lợn vỗ béo Kiểu gen C2C2 C2C4 C4C4 Thế hệ n Số lượng % Số lượng % Số lượng % F0(Y) 4 0 0 3 75,00 1 25,00 F0(MCTH) 12 4 33,33 6 50,00 2 16,67 F1 24 4 16,67 12 50,00 8 33,33 F2 72 11 15,28 35 48,61 26 36,11  112 19 16,96 57 50,90 36 32,14 Mối quan hệ giữa kiểu gen Hormone sinh trưởng và tăng khối lượng Phương pháp so sánh ANOVA là phương pháp kiểm tra thống kê thường được sử dụng để so sánh các giá trị trung bình trên nhiều nhóm mẫu. Trong nghiên cứu này, chúng tôi sử dụng phép phân tích ANOVA một nhân tố để phân tích so sánh sự khác biệt giữa tăng khối lượng trung bình của đàn lợn khi mang 3 kiểu gen C2C2, C2C4 và C4C4. Kết quả nghiên cứu của chúng tôi về TKL trung bình của 3 kiểu gen C2C2, C2C4 và C4C4 trên đàn lợn Y, MCTH và MC lai F1(YxMCTH) và F2(YxMCTH) nuôi tại Bảo Thắng, Lào Cai được trình bày tại Bảng 5. Bảng 5. Quan hệ giữa kiểu gen Hormone sinh trưởng và tăng khối lượng của đàn lợn vỗ béo Thế hệ n=112 Kiểu gen TKL trung bình Độ lệch chuẩn (SD) Sai số chuẩn (SE) Giá trị F Giá trị P Giá trị F0,05 C4C4 800,00 - - C2C4 822,22 11,11 6,41 F0 (Y) 1 3 0 C2C2 - - - 2162,82 0,00046 19 C4C4 394,44 7,85 5,55 C2C4 405,55 6,08 2,48 F0 (MCTH) 2 6 4 C2C2 416,66 6,41 3,20 8,500 0,00844 4,25 C4C4 636,11 5,14 1,81 C2C4 669,44 18,42 5,31 F1 8 12 4 C2C2 713,88 5,55 2,77 43,07 3,69E-08 3,46 C4C4 640,59 12,93 2,52 C2C4 678,09 19,89 3,36 F2 26 35 11 C2C2 719,19 11,21 3,38 93,73 2,12E-20 3,12 Bảng 5 cho thấy ở lợn trong thí nghiệm này, kiểu gen liên quan với tính trạng TKL trong từng giống: Lợn mang kiểu gen C2C2 có TKL cao nhất: không xuất hiện ở lợn Y, 416,66 g/ngày ở lợn MCTH, 713,88 g/ngày ở lợn F1 và 719,19 g/ngày ở lợn F2; trong lúc đó, lợn mang kiểu gen C4C4 có TKL thấp nhất, đó là 800 g/ngày ở lợn Y, 394,44 g/ngày ở lợn MCTH, 636,11 g/ngày ở lợn F1 và 640,59 g/ngày ở lợn F2; lợn mang kiểu gen dị hợp tử C2C4 có TKL trung bình giữa 2 kiểu gen đồng hợp tử: 822,22 g/ngày ở lợn Y, 405,55 g/ngày ở lợn MCTH, 669,44 g/ngày ở lợn F1 và 678,43 g/ngày ở lợn F2. Như vậy, những cá thể lợn mang kiểu gen C2C2 cho TKL cao và những cá thể lợn mang kiểu gen C4C4 có TKL thấp cho phép chúng ta sử VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 78 dụng các kiểu gen này để chọn lọc lợn ngay từ sơ sinh để có thể nâng cao khả năng TKL nhằm góp phần nâng cao hiệu quả kinh tế trong chăn nuôi lợn thịt. Giá trị F thí nghiệm đều lớn hơn so với F0,05 hay các giá trị P tính được đều nhỏ hơn rất nhiều 0,05. Như vậy, sự khác nhau về TKL giữa 3 kiểu gen trên là có ý nghĩa rất rõ rệt về mặt thống kê. Vì số lượng cá thể mang kiểu gen đồng hợp tử (C2C2) xuất hiện trong nghiên cứu với tần số thấp nên chúng tôi gộp với kiểu gen C2C4 thành một nhóm, đồng thời sử dụng phép kiểm tra t giả (t’-Test), với phép kiểm tra sử dụng đường cong chuẩn cả 2 chiều (t-Test: Two Sample Assuming unequal Variances) để kiểm tra sự khác biệt của tính trạng kiểu hình giữa nhóm mang alen C2 (kiểu gen C2C2 và C2C4) và nhóm không mang alen C2 (kiểu gen C4C4). Kết quả cụ thể được trình bày ở Bảng 6. Bảng 6. Kết quả kiểm tra t’ Y MCTH F1 F2 Chỉ tiêu C2C4 C4C4 C2C2/ C2C4 C4C4 C2C2/ C2C4 C4C4 C2C2/ C2C4 C4C4 TKL 822,22 800,00 409,99 394,44 680,55 636,11 687,92 640,59 Phuơng sai mẫu - - 67,21 61,72 650,20 26,45 641,01 167,33 Kích thước mẫu 3 1 10 2 16 8 46 26 Độ tự do 0 1 17 69 t Stat - 2,53 6,70 10,48 P(T<=t) - 0,23 3,69E-06 6,38E-16 t’ - 12,7 2,10 1,99 Kết quả so sánh t-test: t’= 12,7 >t-Start= 2,53 của nhóm MCTH cho thấy sự khác nhau về TKL trung bình giữa 2 nhóm mang alen C2 và không mang alen C2 không biểu hiện sự sai khác rõ rệt về mặt thống kê sinh học (p = 0,23). Ở lợn lai F1 và F2 do t’ <t-Startnên sự khác nhau về TKL trung bình giữa 2 nhóm mang kiểu gen C2C2, C2C4 và đồng hợp tử C4C4 là khác nhau với mức độ tin cậy  = 0,025. Hay sự khác nhau về TKL trung bình của lợn F1 và F2 mang alenC2 và không mang alen C2 là có ý nghĩa thống kê. Allele C2 và C4 đều mang đột biến điểm tại vị trí +378 nhưng khác nhau là C2 không mang đột biến điểm tại vị trí +329 như C4; các đột biến khác nhau dẫn đến các dạng alen định vị ở vùng mã hóa cho peptide tín hiệu của gen GH. Và sự thay đổi này của peptide tín hiệu đã ảnh hưởng đến quá trình tổng hợp và vận chuyển protein. TKL là tính trạng số lượng đa gen. Việc xác định được các gen có ảnh hưởng đến các tính trạng số lượng rất có ý nghĩa trong di truyền giống động vật. Kết quả thu được từ phân tích này khẳng định GH là ứng cử gen liên quan đến tính trạng TKL với mức độ là 1 chỉ thị liên kết với tính trạng TKL. Nghiên cứu này đã xác nhận tính chất đa hình của đoạn gen GH ở lợn MCTH, MC lai và mối tương quan có ý nghĩa thống kê của kiểu gen GH với tính trạng TKL ở giống lợn MC lai. Tuy nhiên, để có thể sử dụng chúng như là 1 chỉ thị di truyền hỗ trợ chọn giống cần phải được khẳng định mối tương quan này với số lượng mẫu lớn hơn ở các thế hệ lợn lai tiếp theo. KẾT LUẬN Tăng khối lượng (TKL) của đàn lợn thí nghiệm tại Bảo Thắng, Lào Cai được xác định là cao: Cao nhất là Y (816,6614,34 g/ngày), thấp nhất ở lợn MCTH (407,409,86 g/ngày) và trung bình ở F1(YxMCTH) là 665,7429,83 g/ngày và F2(YxMCTH) là 670,8331,45g/ngày. Sự sai khác về TKL giữa các nhóm lợn có ý nghĩa thống kê rõ rệt, ngoại trừ giữa hai nhóm F1 và F2. NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn 79 Kết quả so sánh ANOVA một yếu tố cho thấy sự khác nhau có ý nghĩa thống kê về tính trạng TKL giữa 3 kiểu gen C2C2, C2C4, C4C4 của lợn Y, MCTH và MC lai: F1(YxMCTH), F2(YxMCTH) với mức ý nghĩa p<0,05: Lợn mang kiểu gen C2C2 có TKL cao nhất, kiểu gen C2C4 có TKL trung bình và kiểu gen C4C4 có TKL thấp nhất. Với phép kiểm tra t’, sử dụng đường cong phân bố chuẩn 2 chiều cho thấy, ở lợn MCTH không phát hiện được sự khác nhau có ý nghĩa thống kê về TKL trung bình giữa nhóm mang và không mang allele C2. Nhưng ở các cá thể lợn F1 và F2 mang allele C2 (C2C2 và C2C4) và không mang allele C2 (C4C4) lại có sự TKL khác nhau với mức độ tin cậy  = 0,025. TÀI LIỆU THAM KHẢO Asubel F.M., R. Brent. R.E., Kingston. D.D., Moore. J.G., Seidman. J.A., Smith and K., Struhl (1995). Short Protocols in Molecular Biology. 3rd. edn. John Wilet & Sons. Inc. Artur Rybarczyk., Marek Kmiec’., Tadeusz Karamucki and Arkadiusz Terman (2007). “Association of growth hormone gene polymorphism with carcass and meat quality traits in PIC hybrid pigs”. Arch. Tierz. Dummerstorf 50. Special Issue: p.205-213. Nguyễn Vân Anh, Nguyễn Thị Diệu Thúy, Nguyễn Văn Cường và Nguyễn Kim Độ (2005). “Đa hình di truyền gen Myogenin ở lợn Móng Cái”. Tạp chí Công nghệ sinh học 3 (3): p.311-317. Đặng Vũ Bình, Vũ Đình Tôn và Nguyễn Công Oánh (2008). “Năng suất và chất lượng thịt của các tổ hợp lai giữa nái lai F1(YorkshireMong Cai) phối với đực giống Landrace. Duroc và (PietrainDuroc)”. Tạp chí Khoa học và Phát triển. 5:p.418-424. Casas-Carillo E,. Prill-Adam A., Pric S.G., Clutter A.C and Kirkpatrick B.W (1997). “Relationship of growth hormone and Insullin-like growth Factor-1 genotype with growth and carcass traits in swine”. Animal Gene. 28: p.88-93. Cheng W.T.., C.H. Lee., C.M. Hung., T.J. Chang and C.M. Chen (2000). “Growth hormone gene polymorphisms and growth performance traits in Duroc. Landrace and Tao-Yuan pigs”. Theriogenology. 54 (8): p.1225-1237. Duc Nguyen Van (1999). "Growth performance in Vietnamese pigs". AAABG. Australia. 13: p.250-253. Duc N.V (2001). “Crossbreeding effects for the ADG on crossbreds amongst MC. LR and LW” AAABG. NZ. 14: p.35. Nguyễn Văn Đức (1997). Đặc điểm di truyền của lợn nội. ngoại và con lai của chúng nuôi tại Việt Nam. Luận án Tiến sỹ Di truyền học và nhân giống vật nuôi. Trường ĐHTH New England. Australia. Nguyễn Văn Đức, Lê Thanh Hải và Giang Hồng Tuyến (2001). “Nghiên cứu tổ hợp lợn lai Pietrain x Móng Cái tại Đông Anh. Hà Nội”. Tạp chí NN&PTNT. số 6: p.383-384. Nguyễn Văn Đức, Lê Thanh Hải (2002). Phương pháp kiểm tra thống kê sinh học. NXB Khoa học và kỹ thuật, trang 40-57. Nguyễn Văn Đức, Giang Hồng Tuyến và Nguyễn Thị Viễn (2007). “Kết quả chọn lọc 2 nhóm lợn Móng Cái cao sản MC3000 và MC15”. Tạp chí KHCN Chăn nuôi. số 4: p. 7-11. Nguyễn Văn Đức (2009). Báo cáo nghiệm thu đề tài nhánh năm 2009. Franco M.M., Robson C., Antunes R.C., Silva H.D and Goulart L.R (2005). “Association of PIT1. GH and GHRH polymorphisms with performance and carcass traits in Landrace pigs”. J. Appl. Genet. 46 (2): p.195-200. Trần thị Minh Hoàng, P.V. Chung, L.T. Hải và Nguyễn Văn Đức (2003). Khả năng sản xuất của F1(LRxMC). F1(LWxMC). F1(PixMC) ở Đông Anh. Tạp chí NN&PTNN. Số 10: p.1248-1250. Trần Thị Minh Hoàng. Phạm Văn Chung, Lê Thanh Hải và Nguyễn Văn Đức (2003). “Ảnh hưởng của các nhân tố cố định đến tính trạng sản xuất của 3 tổ hợp lai F1(LRxMC). F1(LWxMC) và F1(PixMC) nuôi trong nông hộ huyện Đông Anh -Hà Nội”. TT KHKT Chăn nuôi. Viện Chăn nuôi. 6: p.22-24. Hardge T (1998). “Association between polymorphism of the leptin-gene (LEP) and performance traits in a porcine resource family and in commercial outbred populations”. Proceedings of the XXVI International Conference on Animal Genetics. Auckland. New Zealand. August 9-14. 1998. p.106. Knorr C., G. Moser., E. Muller and H. Geldermann (1997). “Associations of GH gene variants with performance traits in F2 generations of European Wild Boar. Pietrain and Meishan pigs”. Anim. Genet. 28: p.124 -128. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 80 Nielsen V.H., N.J. Larsen and N. Ageegaard (1995). “Association of DNA-polymorphism in the growth hormone gene with basal-plasma growth-hormone concentration and production traits in pigs”.J.Anim.Breed.Genet.112: p.205-212. Pierzchala M.,. Blicharski T and Kuryl J (2004). ”Growth race and carcass qualyti in relation to GH/MspI and GH/HaeII PCR-RFLP polymorphism in pigs”. Anim. sci. Pap. Rep. 22: p.57-64. Polonca Frajman. V.margeta and Gordana Kralic (2008). “Candidate genes for slaughter traits in pigs”. Krmiva 50. Zagreb 5: p.267-273. Nguyễn Thị Diệu Thúy, Nguyễn Thu Thúy và Nguyễn Văn Cường (2004). “Đa hình di truyền gen hormone sinh trưởng ở lợn Móng Cái”. Tạp chí Công nghệ Sinh học 2 (1) : p.19-24. Giang Hồng Tuyến, Nguyễn Văn Đức và Đinh Văn Chỉnh (2006). “Xác định tuổi giết thịt thích hợp đối với giống lợn Móng Cái F1 (Pi x MC) và F1(LWx MC)”. Tạp chí Chăn nuôi. 8: p.4 -6. Giang Hồng Tuyến, Nguyễn Văn Đức và Đinh Văn Chỉnh (2008). “Năng suất sinh sản của nhóm lợn MC3000 và khả năng sản xuất của nhóm lợn MC15 qua 4 thế hệ chọn lọc Tạp chí KHCN Chăn nuôi. 11: p.15-19. Giang Hồng Tuyến (2008). Nghiên cứu chọn lọc nâng cao tính trạng số con sơ sinh sống/ổ đối với nhóm lợn MC3000. khả năng tăng khối lượng và tỷ lệ nạc đối với nhóm lợn MC15. Luận án TS. Nông nghiệp. Viện Chăn nuôi. Urban T; Kucienl J and Mikolásová (2002). “Polymorphism of genes encoding for Ryanodine receptor. growth hormone. leptin and MYC protooncogene protein and meat production in Duroc pigs”. J Anim. Sci. 47 (10): p.411-417. Vize P.D., Wells J.R.E (1997). “Isolation and characterization of the porcine growth hormone gene”. Gene 55: p.339-344. Yerle. M., Y. Lahbib-Mansai., P.D. Thomsen and J. Gellin (1993). “Location of porcine growth hormone gene to chromosome 12p1.2p1.5”. Anim. Genet. 24: p.129-131. Yu. TP.,. Tuggle C.K., Schmitz C.B and Rothschild M.F (1995). “Association of PIT1 polymorphisms with growth and carcass traits in pigs”. Journal of Animal Science. 73: p.1282-1288. *Người phản biện: TS. Trần Xuân Hoàn; TS.Phạm Doãn Lân Lời cảm ơn Công trình có sự hỗ trợ của Chủ nhiệm đề tài trọng điểm cấp Bộ “Nghiên cứu tạo một số dòng lợn đặc trưng và xây dựng chương trình lai hiệu quả, phù hợp với điều kiện chăn nuôi khác nhau” Nguyễn Thị Viễn, Viện KHKT Nông nghiệp miền Nam; Bộ môn Di truyền Giống vật nuôi, Viện Chăn nuôi; Công ty Cổ phần Đầu tư và PT Nông nghiệp Hải Phòng và Gia trại nuôi lợn của ông: Lê Mạnh Quý ở Bảo Thắng - Lào Cai. Nhóm tác giả xin được chân thành cám ơn các quý cơ quan, gia trại và cá nhân đã giúp đỡ. T¹p chÝ khoa häc c«ng nghÖ ch¨n nu«i, lµ c¬ quan ng«n luËn cña ViÖn ch¨n nu«i, trùc thuéc Bé N«ng nghiÖp vµ ph¸t triÓn n«ng th«n. Tõ th¸ng 8 n¨m 2006 ®· ra m¾t b¹n ®äc sè ®Çu tiªn vµ tiÕp tôc xuÊt b¶n th­êng kú 6 sè/n¨m. C¸c Tin bµi vµ ¶nh ®­îc ®¨ng trªn t¹p chÝ lµ nh÷ng c«ng tr×nh nghiªn cøu khoa häc, nh÷ng bµi viÕt trong lÜnh vùc ch¨n nu«i. chóng t«i rÊt mong nhËn ®­îc sù quan t©m, céng t¸c, ñng hé, gióp ®ì cña ®éc gi¶ trong vµ ngoµi n­íc. tõ quý III/2009 t¹p chÝ ®­îc ph¸t hµnh qua c¸c b­u côc ®Þa ph­¬ng trong toµn quèc Trô së: ViÖn Ch¨n nu«i, Thôy Ph­¬ng - Tõ Liªm - Hµ Néi; §iÖn tho¹i: 04.37571453; Fax: 04.38389775; Email: kcc.vcn@gmail.com; Website: http//www.vcn.vnn.vn; Sè l­îng - 500 cuèn. In t¹i Nhµ xuÊt b¶n N«ng nghiÖp-Hµ Néi; sè 22/th¸ng 3-2010 - Nép l­u chiÓu th¸ng 3/2010 Gi¸ b¸n: 15.000®/cuèn

Các file đính kèm theo tài liệu này:

  • pdfb10_moi_quan_he_3584.pdf
Tài liệu liên quan