In this study, seven wild edible mushroom strains were isolated, purely cultivated and
identified to belong to seven genera, Phlebia, Ganoderma, Tricholoma, Polyporus, Panus,
Pleurotus and Phlebopus. The three strains, Phlebia sp. (M10), Ganoderma sp. (M20)
and Pleurotus sp. (M7) were able to form fruiting bodies on the sawdust media supplemented
corn bran or earthworm fertilizer. The sawdust media with 10 or 15 % corn bran and 5 %
earthworm fertilizer showed to give better yields of fruiting bodies than the others. There is
further need in finding of suitable substrates and supplements for cultivation
of Tricholoma, Polyporus, Panus, and Phlebopus. Nutritional and safety assessment of these
isolated strains should also be investigated before applying to mass production of the fruiting
bodies.
12 trang |
Chia sẻ: yendt2356 | Lượt xem: 916 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Isolation and study on pure culture of wild edible mushrooms collected from provinces in the southeast region of Viet Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Science and Technology 55 (1A) (2017) 122-133
DOI: 10.15625/2525-2518/55/1A/12389
ISOLATION AND STUDY ON PURE CULTURE OF WILD EDIBLE
MUSHROOMS COLLECTED FROM PROVINCES IN THE
SOUTHEAST REGION OF VIET NAM
Nguyen Xuan Hoa, Le Thanh Huynh Trang, Tran Trung Hieu,
Le Thi Thanh Loan, Luong Thi My Ngan, Pham Thanh Ho
Faculty of Biology – Biotechnology, University of Science, VNU-HCM,
227 Nguyen Van Cu Street, District 5, Ho Chi Minh City
*
Email: ltmngan@hcmus.edu.vn
Received: 30 October 2016; Accepted for publication: 30 May 2017
ABSTRACT
The present study aimed to characterize, classify and attempt to purely culture wild edible
mushrooms collected from several provinces in the Southeast region of Viet Nam. We isolated
seven mushroom strains that belonged to different genera, Phlebia sp., Ganoderma sp.,
Tricholoma sp., Polyporus sp., Panus sp., Pleurotus sp. and Phlebopus sp. These mushroom
mycelia were able to well grow on both of PGA and modified PGA media. Most of the strains,
except for Phlebopus sp (M3), were able to grow on unhusked rice medium supplemented with
rice bran and corn bran. Among them, Ganoderma sp. (M20) exhibited the highest mycelial
growth rate (7.8 mm/day). The other strains had growth rates of 4.0 - 5.2 mm/day. Rubber tree
sawdust supplemented with corn bran or earthworm fertilizer was used for production of fruiting
bodies. The results indicated that Phlebia sp. (M10) gave better yields of fruiting bodies (536–
539 g/kg dw on the media supplemented with 10 or 15 % corn bran or 5 % earthworm fertilizer)
than those of Ganoderma sp. and Pleurotus sp. (M4), 164 and 153 g/kg dw, respectively, on the
medium with 5 % corn bran. The mycelia from rice grain spawn of the remaining other strains
failed to colonize or form fruiting bodies on the tested substrates.
Keywords: pure culture, wild edible mushroom, Vietnam’s Southeast
1. INTRODUCTION
Mushrooms play important roles to both ecosystem and human health since they constitute
a significant part of terrestrial ecosystems, and they serve as food, medicine, biocontrol agents,
and natural compound producers used in the pharmaceutical and many other industries [1]. The
number of mushroom species on the Earth is estimated at 150,000, and of which only 10 % have
been identified [2, 3], and more than 2,000 are safe for human consumption [4]. They are
gaining popularity owing to their high nutritional values and many health benefits [5].
Mushroom resources have been exploited and their cultivation is promoted in both developed [6]
and developing countries [7].
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
123
Cultivation of edible and medicinal mushroom in Viet Nam has been getting more
developed in recent years. Most of strains cultivated are non-indigenous species although Viet
Nam is evaluated to be one of the countries possessing diversity of mushrooms [8]. In addition,
many wild mushrooms are in danger of extinction due to their overexploitation and
deforestation. There is a need for genetically conversing and introducing native wild mushrooms
to our mushroom industry.
The objectives of this study were to collect and purely culture wild edible mushrooms that
were seasonally gathered for food by local inhabitants in Binh Phuoc, Dong Nai and Tay Ninh
Provinces. Culture media for mycelial growth and fruiting body production of the isolated
strains were also investigated.
2. MATERIALS AND METHODS
2.1. Mushroom isolation
Fruiting bodies of seven mushrooms designated as M2, M3, M4, M7, M8, M10 and M20
were collected from dead or decaying woods in regions of forests, foot of mountains or gardens
at Binh Phuoc, Dong Nai and Tay Ninh Provinces in rainy season. Their internal tissues were
purely cultured and maintained on PGA (Potato Glucose Agar) or modified PGA medium (PGA
supplemented with 3 g/l KH2PO4, 1.5 g/l MgSO4.7H2O + 0.01 g/l vitaminB1). Pure cultures of
the mushroom samples were deposited at the Laboratory of Biotransformation, Department of
Plant Biotech and Biotransformation, University of Science, VNU-HCM.
2.2. Classification methods
Mushroom identification was based on morphological characteristics according
to taxonomy keys described by Le Ba Dung (2003) [9], Trinh Tam Kiet (2011 and 2012) [10, 11]
and Mycokey.org website ( and molecular
method based on sequences of ITS (internal transcribed spacer) region of rDNA. The resulted
gene sequences were manually edited using BioEdit 7.0.9.0 and subjected to NCBI BLAST
search to identify the closest related sequences.
For DNA extraction, the mycelia were subcultured on PGA or modified PGA medium for 7
days.
Genomic DNA was extracted from the seven day-old mycelia, which were freeze-ground in
liquid nitrogen, using spin columns provided by Khoa Thuong Biotech Co., and preserved in
Tris-EDTA buffer solution. The ITS (internal transcribed spacer) region of rDNA of the strains
was amplified with primers for PCR reactions, ITS1-F (5′CTTGGTCATTTAGAGGAAGTAA-
3′) and either ITS4-R (5′TCCTCCGCTTATTGATATGC-3′) or ITS4B-R
(5’CAGGAGACTTGTACACGGTCCAG3’) [12, 13]. The PCR reaction was performed in 25μl
total volume, containing 5µl genomic DNA, 400 nM of each primer, 0.4 mM dNTPs, 1X PCR
buffer, 3 mM MgCl2, and 1U h-Taq DNA polymerase. The thermocycling conditions consisted
of an initial denaturation at 95 ºC for 15 minutes, followed by 40 amplification cycles at 95 ºC
for 30 seconds, 58 ºC for 30 seconds and 72 ºC for 30 seconds, and a final extension at 72 ºC for
10 minutes. The amplified products were purified and sequenced at 1-BASE (Malaysia). The
resulted gene sequence was manually edited using BioEdit 7.0.9.0 and subjected to NCBI
BLAST search to identify the closest related sequences.
Nguyen Xuan Hoa, et al.
124
2.3. Growing mushroom mycelia on PGA and unhusked rice media
Mycelial pieces (1 cm
2
) from the culture plates of each mushroom were placed in the centre
of plates ( , 90 mm) of PGA or modified PGA medium. The plates were incubated subsequently
at 28 ± 2 °C. The growth of mushroom mycelia was recorded once every two days until the
mycelia grew covering entire surface of media. Each treatment was carried out in triplicate.
The cooked unhusked rice was used as a main substrate for the preparation of grain spawns.
After washed and soaked in water for overnight, the unhusked rice seeds were boiled for 15
minutes, subsequently air dried and supplemented with CaCO3 (1 %), rice bran (1 %) and corn
bran (1 %). The substrates were filled into bottles (500 ml) and sterilized in an autoclave at
121 °C and 1 atm for 30 mins. The bottles were allowed to cool to room temperature before
inoculating. The bottles of unhusked rice supplemeted with CaCO3, rice bran and corn bran were
inoculated with the mycelium of each mushroom strain (1 cm
2
) and incubated at 28 ± 2 °C. The
growth of mycelia was recorded once every two days until they fully colonized the culture
medium. The experiment was performed in triplicate.
2.4. Effects of substrates on the growth and yield of fruiting bodies
For production of fruiting bodies, piles of rubber tree sawdust mixed with CaCO3 1 % and
incubated for 24 hrs and supplemented with either corn bran or earthworm fertilizer at their
different concentrations of 5 %, 10 %, 15 %. Aged water was added to the substrates to get a
relative humidity of about 65 %. Amounts of 500 g of the substrates were packed in
polyethylene plastic bag (15 × 23 cm) and pressed to form a cylindrical cake. The substrate bags
were sterilized at 121
o
C for 30 min and then left to cool room temperature before inoculating.
Each the sawdust bag was inoculated with a tablespoon of each mushroom spawn. The bags
were subsequently placed in a room (28 ± 2 °C) with diffused light (200 – 300 lux) and
ventilation. The mycelial growth in the different bags of the substrate materials was recorded
once every day and fruiting body yields were calculated after harvest. Each treatment was
performed in four replicates.
2.5. Statistical analysis
The means ± SE of mycelial growths and fruiting body yields were compared using
ANOVA and the Bonferroni–Dunn’s test for multiple comparisons (SAS 9.3, 2002–2010; SAS
Institute Inc., Cary, NC, USA).
3. RESULTS AND DISCUSSION
3.1. Morphological features and molecular characterization of the mushrooms
In the study, seven edible mushroom samples were collected and classified. Morphological
characteristics such as shape, size, color, and structure of pileus, hymenium and spore of the
seven wild edible mushroom samples were presented in Figure 1 and Table 1. The results
supposed that the seven mushroom strains M2, M3, M4, M7, M8, M10 and M20 belonged to
different genera, Panus, Phlebopus, Tricholoma, Pleurotus, Polyporus, Phlebia, and
Ganoderma, respectively. In addition, the similarity of the nucleotide sequences of the M4, M7,
M8, M10 and M20 and those registered on GenBank shown in Table 2 also supported the results
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
125
(the similarity of 91 – 99 %). The strains M2 and M3 did not possess high similarity with any
sequences on NCBI GenBank, the similarity of 75 and 88 %, respectively.
M2 (Panus sp.) M3 (Phlebopus sp.)
M4 (Tricholoma sp.) M7 (Pleurotus sp.)
Polyporus (M8) M10 (Phlebia sp.)
A B
C
A
B
C
A B
C D
A B
C D
A B
C
A B
D
5 m
A
B
C
5 m
Nguyen Xuan Hoa, et al.
126
M20 (Ganoderma sp.)
Figure 1. Mushrooms: undersurface (A) and uppersurface (B) of pileus, hyphal system (C) and spores (D)
Table 1. Morphological and habitat characteristics of mushroom samples
Samples Description
Habitat & Collection
Position
M2 A polypore
Pileus: 5 – 10 cm, pale brown to reddish brown with
velutinous surface and decurrent lamellae, Gill spacing:
crowded; Stipe: 20–250 × 2–10 mm long and thick,
concolorous with the pileus
Hyphal system: dimitic with clamp connections
Supposed species: Panus sp.
On soil with decayed plants
under tree shades
Nam Cat Tien Forest, Dong
Nai
M3 A Bolete
Pileus: 13–18 cm in width, semiglobose dark yellow,
concolour; Big central stipe (8–15 cm height and 2–4 cm
width); Flesh: yellowish and soft
Basidia: no clamp connection
Supposed species: Phlebopus sp.
On soil in mango gardens
Chua Chan Mountain,
Dong Nai
M4 An agaric
Pileus: large 14–16 cm, planoconvex, white radially
fibrillose with incurved margin; Big central stipe (~2.5 x15
cm); Lamellae: white and adnexed; Flesh: white, soft
Usually grow in clusters
Spore print: white; Spores: ellipsoid
Hyphal system: branches with septates and clamp
connections
Supposed species: Tricholoma sp.
On soil with decaying
rubber trees
Rubber gardens, Tay Ninh
D
A
C
B
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
127
M7 An agaric
Pileus: 5–7 cm (width) & 1–1.5 cm (height), depressed
funnel, smooth on the upper surface; Lamellae: decurrent,
fibrillose and white; Gill spacing: medium; Stipe: long (1–
1.5 cm in width, 5–9 cm); fleshy without veil
Spore print: white. Spores: smooth and round or ellipsoid.
Hyphal system: monomitic with clamp connections.
Supposed species: Pleurotus sp.
On decaying wood trees
Hon Quan Forest, Binh
Phuoc
M8 A polypore
Pileus: 5–7 cm, ivory color, very thin with fanned shape;
Short lateral stipe (1 cm); Flesh texture: rather tough
Basidia: many big pores
Hyphal system: dimitic with clamp connection
Supposed species: Polyporus sp.
On dying plant stems
Chua Chan Mountain,
Dong Nai
M10 A polypore
Pelius: 2–6 cm, white or ivory, smooth rounded spines on
under surface; initially tiny nodules, later depressed fanned-
shape with thin margin and fasciulate, usually in clusters,
soft fleshed, fibrous, gelatinous and slight crunchy in young
and slightly tough in age; Short central stipe
Spore print: white, Spores: smooth ellipsoid colorless (4x3
m)
Hyphal system: monomitic, branched hyphae with clamp
connections and very few or without septa
Supposed species: Phlebia sp.
Dead wood such as fallen
branches or on moist soil
with decayed leaves.
Thong Nhat Forest, Binh
Phuoc
M20 A polypore
Pelius: 7–16 cm, grooves, texture: slightly tough and edible
in young, and hard woody in age, Upper surface: initially
black with light brown wavy or smooth margin (0.4–0.7 cm
thick), and completely black in age, Under-surface: many
pores, initially whitish, and brown and black in age; No stipe
Usually grow separately, rarely in clusters
Hyphae system: dimitic with clamp connections. Spore
print: brown. Spores: ellipsoid with thick wall (10.2 –13µm
x 15–18 µm).
Supposed species: Ganoderma sp.
On dead wood trees
Chua Chan Mountain,
Dong Nai
The seven mushroom strains isolated in this study are rather abundant in some fruit or
rubber tree gardens, forests or foot of mountains in Southern Viet Nam. They have been
gathered for food by villagers, monks, loggers, and local inhabitants but not cultivated and
commercialized yet. The five strains classified into the five genera Tricholoma, Polyporus,
Pleurotus, Panus and Ganoderma are common and well-recorded in Viet Nam [10, 11]. The
first three genera include many valuable edible species. The other two genera, Phlebopus and
Phlebia have been not well documented in Viet Nam, except few recent recordings about
Nguyen Xuan Hoa, et al.
128
Phlebopus [14, 15] and Phlebia [16]. Several species of Phlebopus, such as P. spongiosus, a
Vietnamese endemic species [15] and P. portentosus [17] that occur in fruit gardens, have been
described as valuable edible ectomycorrhizal mushrooms. However, they can produce
sporocarps in artificial cultures without host plants [15, 17] and the media for their cultivation
are complex and comprised of many ingredients [17]. Species belonging genus Phlebia rarely
are considered to be edible or medicinal mushrooms. However, some reports have recently
mentioned about their edible or medicinal properties [18, 19].
Table 2. The similarity of the nucleotide sequences of the samples and those of species registered in
GenBank
Mushroom
Samples
Matched Species
GenBank
Accession
Query
coverage
E Value
Maximal
Identity
M2 Panus velutinus KT956126.1 97 % 7e-59 75 %
M3 Phlebopus portentosus JQ623510.1 99 % 0.0 88 %
M4 Tricholoma giganteum JX041888.1 100 % 0.0 91 %
M7
Pleurotus giganteus
(Panus giganteus)
HM245785.1 98 % 0.0 94 %
M8
Polyporus emerici
(Favolus emerici)
KM385430.1 100 % 0.0 99 %
M10 Phlebia sp. KJ654588.1 98 % 0.0 93 %
M20 Ganoderma subresinosum KJ654376.1 96 % 0.0 99 %
3.2. Growing mushroom mycelia on PGA and unhusked rice media
Table 3. Mycelial growth rates of the strains on agar media
Samples Scientific Name
Growth rate of mycelium
*
(mm/day)
PGA PGA cải tiến
M20 Ganoderma sp. 7.48
b
± 0.29 9.17
a
± 0.56
M10 Phlebia sp. 7.41
b
± 0.22 4.89
c
± 0.14
M4 Tricholoma sp. 4.09
d
± 0.07 4.02
de
± 0.06
M7 Pleurotus sp. 3.68
def
± 0.22 2.96
gh
± 0.08
M8 Polyporus sp. 3.66
ef
± 0.11 3.66
ef
± 0.23
M2 Panus sp. 2.99
g
± 0.07 3.53
f
± 0.08
M3 Phlebopus sp. 1.95
i
± 0.26 2.55
h
± 0.11
*
Averages ± SE followed by the same small letters in the columns do not significantly differ at P ≥ 0.05.
All the strains were capable of growing on the both PGA and modified PGA media (Table
3). The M20 and M10 strains had higher growth rates (4.9–9.1 mm/day) than M4, M7, M8 and
M2 strains (3.0–4.1 mm/day). The M3 showed the lowest growth on the both media. The M20
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
129
took the shortest time for fully colonizing on the culture media, 5.4 and 4.4 days on the PGA and
modified PGA, respectively.
Most of the strains, except for M3, were capable of growing on the unhusked rice substrate
(Table 4), especially M20 had the highest growth rate of spawn (7.8 mm/day), took only 13.8
days for fully colonizing on the culture substrate while the others had growth rates of 4.0 – 5.2
mm/day and took 21.2 – 27.6 days for fully colonizing the substrate.
Table 4. Spawn growth on unhusked rice substrate
Samples Scientific Name
Growth of spawn
*
Growth rate (mm/day)
Time for full colonization on
substrate (days)
M20 Ganoderma sp. 7.98
a
± 0.27 13.83
a
± 0.48
M10 Phlebia sp. 5.19
b
± 0.18
21.22
b
± 0.79
M8 Polyporus sp. 4.69
c
± 0.30
23.56
b
± 1.45
M2 Panus sp. 4.60
c
± 0.18
23.97
b
± 0.94
M7 Pleurotus sp. 4.06
d
± 0.11
27.17
c
± 0.74
M4 Tricholoma sp. 4.00
d
± 0.12
27.58
c
± 0.80
M3 Phlebopus sp. 0.0 ND
*
Averages ± SE followed by the same small letters in the columns do not significantly differ at P ≥ 0.05.
ND, no determination.
3.3. Effects of substrates on the growth and yield of fruiting bodies
Among the strains that were able to grow on the unhusked rice substrate and were therefore
inoculated in culture bags for fruiting body production, the three strains M7, M10 and M4 were
found to grow on all the tested media, while M20 failed to colonize on the media supplemented
with corn bran of 15 % (C15), or earthworm fertilizer of 10 % (EF10) or 15 % (EF15) (Figure
2). The M7 spawn exhibited faster spreading, took only 13.3–15.0 days for fully colonizing the
substrate bags, than M4 and M10 that took 22–29 days, and the M20 showed the lowest growth
rate. The remaining strains M8 and M2 failed to colonize or grew very weak on all the tested
substrates. The M10 gave more yields of fruiting bodies than M7 and M20 (Figures 3 & 4)
although M7 formed fruiting bodies earliest. The M4 strain failed to form fruiting bodies. The
results also revealed that among the media, the C5 (5% corn bran) gave mycelial growth better
than the others. However, CB10, CB15 and EF5 media gave better yields of fruiting bodies in
the strain M10 (Figure 3).
The seven mushroom strains isolated in this study are rather abundant in some fruit or
rubber tree gardens, forests or foot of mountains in Southern Viet Nam. They have been
gathered for food by villagers, monks, loggers, and local inhabitants but not cultivated and
commercialized yet. The five strains classified into the five genera Tricholoma, Polyporus,
Pleurotus, Panus and Ganoderma are common and well-recorded in Viet Nam. The first three
genera include many valuable edible species. The other two genera, Phlebopus and Phlebia have
Nguyen Xuan Hoa, et al.
130
been not well- documented in Viet Nam, except few recent recordings about Phlebopus [14, 15]
and Phlebia [16]. Several species of Phlebopus, such as P. spongiosus, a Vietnamese endemic
species [15] and P. portentosus [17] that occur in fruit gardens, have been described as valuable
edible ectomycorrhizal mushrooms. However, they can produce sporocarps in artificial cultures
without host plants [15, 17] and the media for their cultivation are complex and comprised of
many ingredients [17]. Species belonging genus Phlebia rarely are considered to be edible or
medicinal mushrooms. However, some reports have recently mentioned about its edible or
medicinal properties [18, 19].
Figure 2. Spawn growth on rubber tree sawdust supplemented with corn bran and earthworm fertilizer.
CB5, CB10 and CB15, media supplemented with 5, 10, 15 % corn bran, respectively; EF5, EF10, EF15,
media supplemented with 5, 10, 15 % earthworm fertilizer, respectively; Control, the medium without
corn bran and earthworm fertilizer;
–
failed to form fruiting body
Figure 3. Yield of fruiting bodies of strains on different media. CB5, CB10 and CB15, media
supplemented with 5, 10, 15 % corn bran, respectively; EF5, EF10, EF15, media supplemented with 5, 10,
15 % earthworm fertilizer, respectively; Control, the medium without corn bran and earthworm fertilizer.
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
131
Aiming for screening the mushroom isolates easily growable on simple media, we used
potatoes and glucose (in PGA or modified PGA media), unhusked-rice and rubber wood sawdust
as major substrates for mycelial propagation and basidiocarp production. According to Diego
(2017), sawdust, cottonseed hulls, ground corncobs, and straw supplemented with rice bran,
wheat bran, corn brain, millet, corns and sorghum meal are common ingredients in mushroom
cultivation [20]. The wood sawdust is more suitable for mushroom cultivation than other
agricultural waste materials such as coconut leaves, banana leaves, rice straw, coconut coir dust,
and bagasse [21]. In Viet Nam, rubber wood sawdust is cheap material and available since
rubber wood is one the major sources of wood processing industry. Our study revealed that the
mycelia of strains Phlebia M10 and Pleurotus M7 generally grew strong and fast on all tested
media, especially Phlebia M10. The strain Ganoderma M20 was able to grow successfully on
PGA, modified PGA, and unhusked-rice media and form fruiting bodies on rubber tree sawdust
supplemented with corn bran or earthworm fertilizer at low concentrations. The high
concentration of the corn bran or earthworm fertilizer in the media resulted in failure of mycelia
growth and fruiting body formation of this strain. In our previous study, the corn bran at
concentration of 10 % or earthworm fertilizer at concentration of 5 % supplemented in rubber
wood sawdust was able to enhance production of spawn and fruiting bodies of L. squarrosulus.
A study of Donini et al. (2009) on effects of different kinds of bran supplemented in elephant
grass substrate on productiveness and biological efficiency of three strains of P. ostreatus
indicated that the media supplemented with wheat, rice or corn bran gave higher yield than those
with soybean bran [22]. The study also discussed effects of C/N ratios in supplements on the
efficiency of production [22]. According to Royse [23], production of mushroom depends on the
genetic nature of mushroom species, nutritional quality and structure of substrates. For example,
cereal brans are sources of organic nitrogen, necessary to the mycelial growth and biological
efficiency of mushrooms [22]; earthworm casting can stimulate carpophore formation of fungi,
such as in Agaricus bisporus [24], and Pleurotus tuberregium [25].
Figure 4. Fruiting bodies of strains M10, M7 and M20 at immature stage
The present study indicated that mycelia of the strain Phlebopus M3 was not able to form
spawn on unhusked-rice. This mushroom may require a rich nutrient medium. Kumla et al. [17]
purely cultured fungus Phlebopus on fungal-host agar, a synthetic medium consisting
complicated mixture of many macro- and micro-element compounds and vitamins. Ji et al. [26]
successfully produced fruiting bodies of Phlebopus portentosus by using non-sterilized
agricultural soil-cased sawdust logs. The spawn of Polyporus M8, Panus M2 and Tricholoma
M4 in our study was not capable of spreading or forming primordia on rubber sawdust substrate.
They may need other suitable substrates such as, Simarouba amara, Astrocaryum aculeatum
sawdust [27], or internal sheath of Bactris gasipaes [28] for Panus strigellus; oak sawdust, corn
bran, rice bran, and wheat bran for Tricholoma giganteum [29].
Nguyen Xuan Hoa, et al.
132
4. CONCLUSION
In this study, seven wild edible mushroom strains were isolated, purely cultivated and
identified to belong to seven genera, Phlebia, Ganoderma, Tricholoma, Polyporus, Panus,
Pleurotus and Phlebopus. The three strains, Phlebia sp. (M10), Ganoderma sp. (M20)
and Pleurotus sp. (M7) were able to form fruiting bodies on the sawdust media supplemented
corn bran or earthworm fertilizer. The sawdust media with 10 or 15 % corn bran and 5 %
earthworm fertilizer showed to give better yields of fruiting bodies than the others. There is
further need in finding of suitable substrates and supplements for cultivation
of Tricholoma, Polyporus, Panus, and Phlebopus. Nutritional and safety assessment of these
isolated strains should also be investigated before applying to mass production of the fruiting
bodies.
Acknowledgments. This research was supported by grant from The Department of Science and
Technology (Ho Chi Minh City) to Pham Thanh Ho.
REFERENCES
1. Duarte S., Pascoal C., Cassio F. and Barlocher F. - Aquatic hyphomycete diversity and
identity affect leaf litter decomposition in microcosms. Oecologia 147 (2006) 658-666.
2. Mueller G. M. and Schmit J. P. - Fungal biodiversity: What do we know? What can we
predict?, Biodivers Conserv 16 (1) (2007) 1–5.
3. Kirk P. M., Cannon P. F., Minter D. W. and Stalpers J. A. - Ainsworth and Bisby’s
Dictionary of the Fungi (10th edition), CABI, Wallingford, UK (2008) 1–771.
4. Wasser S. P. - Medicinal mushrooms as a source of antitumor and immunomodulating
polysaccharides, Appl Microbiol Biotechnol 60 (3) (2002) 258–274.
5. Muhammad B. L. and Suleiman B. - Global development of mushroom biotechnology, Int
J Emerg Trends Sci Technol 2 (06) (2015) 2660–2669.
6. Okhuoya J., Akpaja E., Osemwegie O., Oghenekaro A. and Ihayere C. - Nigerian
mushrooms: underutilized non-wood forest resources, JASEM 14 (1) (2010) 43–54.
7. Ray R. C. and Ward O. P. - Microbial Biotechnology in Horticulture, Science Publishers,
CRC 3 (2008) 1–190.
8. Bao T. T. and Kiet T. T. - Diversity of macro fungi in Viet Nam and their resource value,
Proceedings of the 1st National scientific conference of Viet Nam Natural Museum
System (2011) 97–104.
9. Le B. D. - Macro Fungi in Highland Tay Nguyen Viet Nam. Natural Science and
Technology Publisher (2003) 1–285, (in Vietnamese).
10. Trinh T. K. - Macrofungi of Viet Nam, Hanoi. Natural Science and Technology Publisher,
2 nd edition, Vol. 1 (2011) 1–314, (in Vietnamese).
11. Trinh T. K. - Macrofungi of Viet Nam, Hanoi: Natural Science and Technology
Publisher, 2 nd edition. Vol. 2 (2012) 1–412, (in Vietnamese).
12. White T. J., Bruns T. D., Lee S. B. and Taylor J. W. - Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics, In: PCR Protocols: A
Guide to Methods and Applications, Academic Press Inc., New York (1990) 315–322.
13. Gardes M. and Bruns T. D. - ITS primers with enhanced specificity for basidiomycetes‐
application to the identification of mycorrhizae and rusts, Mol Ecol 2 (2) (1993) 113–118.
Isolation and study on pure culture of wild edible mushrooms collected from Provinces
133
14. Pham N. D. H., Takahashi H., Fukiharu T., Shimizu K., Le B. D. and Suzuki A. -
Phlebopus spongiosus sp. nov. (Boletales, Boletinellaceae) with a sponge-like tissue,
Mycotaxon 119 (1) (2012) 27–34.
15. Pham N. D. H., Yamada A., Shimizu K., Noda K., Dang L. A. T., and Suzuki A. - A
sheathing mycorrhiza between the tropical bolete Phlebopus spongiosus and Citrus
maxima, Mycoscience 53 (5) (2012) 347–353.
16. Nakasone K. K. - Mycoaciella, A synonym of Phlebia, Mycotaxon Vol. LXXXI (2002)
477–490.
17. Kumla J., Hobbie E. A., Suwannarach N. and Lumyong S. - The ectomycorrhizal status of
a tropical black bolete, Phlebopus portentosus, assessed using mycorrhizal synthesis and
isotopic analysis, Mycorrhiza 26 (4) (2016) 333–343.
18. Hai B. T., Suhara H., Doi K., Ishikawa H., Fukami K., Parajuli G. P., Katakura Y.,
Yamashita S., Watanabe K., Adhikari M. K., Manandhar H. K., Kondo R. and Shimizu K.
- Wild mushrooms in Nepal: some potential candidates as antioxidant and ACE-inhibition
sources, eCAM (2014) 1–11.
19. Arko P. F., Marzuki B.M. and Kusmora J. - The inventory of edible mushroom in
Kamojang Nature Reserve and Nature Park, West Java, Indonesia. Biodiversitas 18 (2017)
530–540.
20. Diego C. Z. and Pardo-Giménez A. (eds). - Edible and Medicinal Mushrooms.
Technology and Applications. John Wiley & Sons, Ltd., Chichester, UK (2017) 1–312.
21. Ediriweera S. S., Wijesundera R. L. C., Nanayakkara C. M. and Weerasena O. V. D. S. J.
- Comparative study of growth and yield of edible mushrooms, Schizophyllum commune
Fr., Auricularia polytricha (Mont.) Sacc. and Lentinus squarrosulus Mont. on
lignocellulosic substrates. Mycosphere 6 (6) (2015) 760–765.
22. Donini L. P., Bernardi E., Minotto E. and Do Nascimento J. S. Cultivation of shimejii on
elephant grass substrate supplemented with different kinds of bran. Scientia Agraria 10 (1)
(2009) 067–074.
23. Royse D. J. - Influence of spawn rate and commercial delayed release nutrient levels on
Pleurotus cornucopiae (oyster mushroom) yield, size, and time to production. Appl
Microbiol Biotechnol 58 (4) (2002) 527–531.
24. Grappelli A., Galli E. and Tomati U. - Earthworm casting effect on Agaricus bisporus
fructification. Agrochimica Vol. XXXI (4-5) (1987) 457–462.
25. Omowumi I. O. and Kadiri M. - The Use of Earthworm Cast as a Casing Material, Time
of Application and Substrate size on Yield of Pleurotus tuberregium (Fr.) Singer, a
Nigerian Mushroom. Nature Sci 11 (4) (2013) 4–8.
26. Ji K. P., Cao Y., Zhang C. X., He M. X., Liu J., Wang W. B. and WangY. - Cultivation of
Phlebopus portentosus, in southern China. Mycol Prog 10 (2011) 293–300.
27. Vargas-Isla R., Hanada R. E. and Ishikawa N. K. - Sawdust and fruit residues of Central
Amazonian for Panus strigellus spawn’s production. Pesq Flor Bras 32 (70) (2012) 123-
128.
28. Vargas-Isla R., Yuyama L. K. O., Aguiar J. P. L. and Ishikawa N. K. - Production of
Panus strigellus spawn using the internal sheath of peach palm (Bactris gasipaes) as a
substrate. Interciencia 38 (10) (2013) 733–736.
29. Yoshikazy M. and Mizuno T. (1997). - Cultivation of Niohshimeji (Tricholoma
giganteum). Food Rev Int 13 (3) (1997) 413–418.
Các file đính kèm theo tài liệu này:
12389_103810384591_1_pb_463_2061124.pdf