Isolation and study on pure culture of wild edible mushrooms collected from provinces in the southeast region of Viet Nam

In this study, seven wild edible mushroom strains were isolated, purely cultivated and identified to belong to seven genera, Phlebia, Ganoderma, Tricholoma, Polyporus, Panus, Pleurotus and Phlebopus. The three strains, Phlebia sp. (M10), Ganoderma sp. (M20) and Pleurotus sp. (M7) were able to form fruiting bodies on the sawdust media supplemented corn bran or earthworm fertilizer. The sawdust media with 10 or 15 % corn bran and 5 % earthworm fertilizer showed to give better yields of fruiting bodies than the others. There is further need in finding of suitable substrates and supplements for cultivation of Tricholoma, Polyporus, Panus, and Phlebopus. Nutritional and safety assessment of these isolated strains should also be investigated before applying to mass production of the fruiting bodies.

pdf12 trang | Chia sẻ: yendt2356 | Lượt xem: 991 | Lượt tải: 1Freedownload
Bạn đang xem nội dung tài liệu Isolation and study on pure culture of wild edible mushrooms collected from provinces in the southeast region of Viet Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Science and Technology 55 (1A) (2017) 122-133 DOI: 10.15625/2525-2518/55/1A/12389 ISOLATION AND STUDY ON PURE CULTURE OF WILD EDIBLE MUSHROOMS COLLECTED FROM PROVINCES IN THE SOUTHEAST REGION OF VIET NAM Nguyen Xuan Hoa, Le Thanh Huynh Trang, Tran Trung Hieu, Le Thi Thanh Loan, Luong Thi My Ngan, Pham Thanh Ho Faculty of Biology – Biotechnology, University of Science, VNU-HCM, 227 Nguyen Van Cu Street, District 5, Ho Chi Minh City * Email: [email protected] Received: 30 October 2016; Accepted for publication: 30 May 2017 ABSTRACT The present study aimed to characterize, classify and attempt to purely culture wild edible mushrooms collected from several provinces in the Southeast region of Viet Nam. We isolated seven mushroom strains that belonged to different genera, Phlebia sp., Ganoderma sp., Tricholoma sp., Polyporus sp., Panus sp., Pleurotus sp. and Phlebopus sp. These mushroom mycelia were able to well grow on both of PGA and modified PGA media. Most of the strains, except for Phlebopus sp (M3), were able to grow on unhusked rice medium supplemented with rice bran and corn bran. Among them, Ganoderma sp. (M20) exhibited the highest mycelial growth rate (7.8 mm/day). The other strains had growth rates of 4.0 - 5.2 mm/day. Rubber tree sawdust supplemented with corn bran or earthworm fertilizer was used for production of fruiting bodies. The results indicated that Phlebia sp. (M10) gave better yields of fruiting bodies (536– 539 g/kg dw on the media supplemented with 10 or 15 % corn bran or 5 % earthworm fertilizer) than those of Ganoderma sp. and Pleurotus sp. (M4), 164 and 153 g/kg dw, respectively, on the medium with 5 % corn bran. The mycelia from rice grain spawn of the remaining other strains failed to colonize or form fruiting bodies on the tested substrates. Keywords: pure culture, wild edible mushroom, Vietnam’s Southeast 1. INTRODUCTION Mushrooms play important roles to both ecosystem and human health since they constitute a significant part of terrestrial ecosystems, and they serve as food, medicine, biocontrol agents, and natural compound producers used in the pharmaceutical and many other industries [1]. The number of mushroom species on the Earth is estimated at 150,000, and of which only 10 % have been identified [2, 3], and more than 2,000 are safe for human consumption [4]. They are gaining popularity owing to their high nutritional values and many health benefits [5]. Mushroom resources have been exploited and their cultivation is promoted in both developed [6] and developing countries [7]. Isolation and study on pure culture of wild edible mushrooms collected from Provinces 123 Cultivation of edible and medicinal mushroom in Viet Nam has been getting more developed in recent years. Most of strains cultivated are non-indigenous species although Viet Nam is evaluated to be one of the countries possessing diversity of mushrooms [8]. In addition, many wild mushrooms are in danger of extinction due to their overexploitation and deforestation. There is a need for genetically conversing and introducing native wild mushrooms to our mushroom industry. The objectives of this study were to collect and purely culture wild edible mushrooms that were seasonally gathered for food by local inhabitants in Binh Phuoc, Dong Nai and Tay Ninh Provinces. Culture media for mycelial growth and fruiting body production of the isolated strains were also investigated. 2. MATERIALS AND METHODS 2.1. Mushroom isolation Fruiting bodies of seven mushrooms designated as M2, M3, M4, M7, M8, M10 and M20 were collected from dead or decaying woods in regions of forests, foot of mountains or gardens at Binh Phuoc, Dong Nai and Tay Ninh Provinces in rainy season. Their internal tissues were purely cultured and maintained on PGA (Potato Glucose Agar) or modified PGA medium (PGA supplemented with 3 g/l KH2PO4, 1.5 g/l MgSO4.7H2O + 0.01 g/l vitaminB1). Pure cultures of the mushroom samples were deposited at the Laboratory of Biotransformation, Department of Plant Biotech and Biotransformation, University of Science, VNU-HCM. 2.2. Classification methods Mushroom identification was based on morphological characteristics according to taxonomy keys described by Le Ba Dung (2003) [9], Trinh Tam Kiet (2011 and 2012) [10, 11] and Mycokey.org website ( and molecular method based on sequences of ITS (internal transcribed spacer) region of rDNA. The resulted gene sequences were manually edited using BioEdit 7.0.9.0 and subjected to NCBI BLAST search to identify the closest related sequences. For DNA extraction, the mycelia were subcultured on PGA or modified PGA medium for 7 days. Genomic DNA was extracted from the seven day-old mycelia, which were freeze-ground in liquid nitrogen, using spin columns provided by Khoa Thuong Biotech Co., and preserved in Tris-EDTA buffer solution. The ITS (internal transcribed spacer) region of rDNA of the strains was amplified with primers for PCR reactions, ITS1-F (5′CTTGGTCATTTAGAGGAAGTAA- 3′) and either ITS4-R (5′TCCTCCGCTTATTGATATGC-3′) or ITS4B-R (5’CAGGAGACTTGTACACGGTCCAG3’) [12, 13]. The PCR reaction was performed in 25μl total volume, containing 5µl genomic DNA, 400 nM of each primer, 0.4 mM dNTPs, 1X PCR buffer, 3 mM MgCl2, and 1U h-Taq DNA polymerase. The thermocycling conditions consisted of an initial denaturation at 95 ºC for 15 minutes, followed by 40 amplification cycles at 95 ºC for 30 seconds, 58 ºC for 30 seconds and 72 ºC for 30 seconds, and a final extension at 72 ºC for 10 minutes. The amplified products were purified and sequenced at 1-BASE (Malaysia). The resulted gene sequence was manually edited using BioEdit 7.0.9.0 and subjected to NCBI BLAST search to identify the closest related sequences. Nguyen Xuan Hoa, et al. 124 2.3. Growing mushroom mycelia on PGA and unhusked rice media Mycelial pieces (1 cm 2 ) from the culture plates of each mushroom were placed in the centre of plates ( , 90 mm) of PGA or modified PGA medium. The plates were incubated subsequently at 28 ± 2 °C. The growth of mushroom mycelia was recorded once every two days until the mycelia grew covering entire surface of media. Each treatment was carried out in triplicate. The cooked unhusked rice was used as a main substrate for the preparation of grain spawns. After washed and soaked in water for overnight, the unhusked rice seeds were boiled for 15 minutes, subsequently air dried and supplemented with CaCO3 (1 %), rice bran (1 %) and corn bran (1 %). The substrates were filled into bottles (500 ml) and sterilized in an autoclave at 121 °C and 1 atm for 30 mins. The bottles were allowed to cool to room temperature before inoculating. The bottles of unhusked rice supplemeted with CaCO3, rice bran and corn bran were inoculated with the mycelium of each mushroom strain (1 cm 2 ) and incubated at 28 ± 2 °C. The growth of mycelia was recorded once every two days until they fully colonized the culture medium. The experiment was performed in triplicate. 2.4. Effects of substrates on the growth and yield of fruiting bodies For production of fruiting bodies, piles of rubber tree sawdust mixed with CaCO3 1 % and incubated for 24 hrs and supplemented with either corn bran or earthworm fertilizer at their different concentrations of 5 %, 10 %, 15 %. Aged water was added to the substrates to get a relative humidity of about 65 %. Amounts of 500 g of the substrates were packed in polyethylene plastic bag (15 × 23 cm) and pressed to form a cylindrical cake. The substrate bags were sterilized at 121 o C for 30 min and then left to cool room temperature before inoculating. Each the sawdust bag was inoculated with a tablespoon of each mushroom spawn. The bags were subsequently placed in a room (28 ± 2 °C) with diffused light (200 – 300 lux) and ventilation. The mycelial growth in the different bags of the substrate materials was recorded once every day and fruiting body yields were calculated after harvest. Each treatment was performed in four replicates. 2.5. Statistical analysis The means ± SE of mycelial growths and fruiting body yields were compared using ANOVA and the Bonferroni–Dunn’s test for multiple comparisons (SAS 9.3, 2002–2010; SAS Institute Inc., Cary, NC, USA). 3. RESULTS AND DISCUSSION 3.1. Morphological features and molecular characterization of the mushrooms In the study, seven edible mushroom samples were collected and classified. Morphological characteristics such as shape, size, color, and structure of pileus, hymenium and spore of the seven wild edible mushroom samples were presented in Figure 1 and Table 1. The results supposed that the seven mushroom strains M2, M3, M4, M7, M8, M10 and M20 belonged to different genera, Panus, Phlebopus, Tricholoma, Pleurotus, Polyporus, Phlebia, and Ganoderma, respectively. In addition, the similarity of the nucleotide sequences of the M4, M7, M8, M10 and M20 and those registered on GenBank shown in Table 2 also supported the results Isolation and study on pure culture of wild edible mushrooms collected from Provinces 125 (the similarity of 91 – 99 %). The strains M2 and M3 did not possess high similarity with any sequences on NCBI GenBank, the similarity of 75 and 88 %, respectively. M2 (Panus sp.) M3 (Phlebopus sp.) M4 (Tricholoma sp.) M7 (Pleurotus sp.) Polyporus (M8) M10 (Phlebia sp.) A B C A B C A B C D A B C D A B C A B D 5 m A B C 5 m Nguyen Xuan Hoa, et al. 126 M20 (Ganoderma sp.) Figure 1. Mushrooms: undersurface (A) and uppersurface (B) of pileus, hyphal system (C) and spores (D) Table 1. Morphological and habitat characteristics of mushroom samples Samples Description Habitat & Collection Position M2 A polypore Pileus: 5 – 10 cm, pale brown to reddish brown with velutinous surface and decurrent lamellae, Gill spacing: crowded; Stipe: 20–250 × 2–10 mm long and thick, concolorous with the pileus Hyphal system: dimitic with clamp connections Supposed species: Panus sp. On soil with decayed plants under tree shades Nam Cat Tien Forest, Dong Nai M3 A Bolete Pileus: 13–18 cm in width, semiglobose dark yellow, concolour; Big central stipe (8–15 cm height and 2–4 cm width); Flesh: yellowish and soft Basidia: no clamp connection Supposed species: Phlebopus sp. On soil in mango gardens Chua Chan Mountain, Dong Nai M4 An agaric Pileus: large 14–16 cm, planoconvex, white radially fibrillose with incurved margin; Big central stipe (~2.5 x15 cm); Lamellae: white and adnexed; Flesh: white, soft Usually grow in clusters Spore print: white; Spores: ellipsoid Hyphal system: branches with septates and clamp connections Supposed species: Tricholoma sp. On soil with decaying rubber trees Rubber gardens, Tay Ninh D A C B Isolation and study on pure culture of wild edible mushrooms collected from Provinces 127 M7 An agaric Pileus: 5–7 cm (width) & 1–1.5 cm (height), depressed funnel, smooth on the upper surface; Lamellae: decurrent, fibrillose and white; Gill spacing: medium; Stipe: long (1– 1.5 cm in width, 5–9 cm); fleshy without veil Spore print: white. Spores: smooth and round or ellipsoid. Hyphal system: monomitic with clamp connections. Supposed species: Pleurotus sp. On decaying wood trees Hon Quan Forest, Binh Phuoc M8 A polypore Pileus: 5–7 cm, ivory color, very thin with fanned shape; Short lateral stipe (1 cm); Flesh texture: rather tough Basidia: many big pores Hyphal system: dimitic with clamp connection Supposed species: Polyporus sp. On dying plant stems Chua Chan Mountain, Dong Nai M10 A polypore Pelius: 2–6 cm, white or ivory, smooth rounded spines on under surface; initially tiny nodules, later depressed fanned- shape with thin margin and fasciulate, usually in clusters, soft fleshed, fibrous, gelatinous and slight crunchy in young and slightly tough in age; Short central stipe Spore print: white, Spores: smooth ellipsoid colorless (4x3 m) Hyphal system: monomitic, branched hyphae with clamp connections and very few or without septa Supposed species: Phlebia sp. Dead wood such as fallen branches or on moist soil with decayed leaves. Thong Nhat Forest, Binh Phuoc M20 A polypore Pelius: 7–16 cm, grooves, texture: slightly tough and edible in young, and hard woody in age, Upper surface: initially black with light brown wavy or smooth margin (0.4–0.7 cm thick), and completely black in age, Under-surface: many pores, initially whitish, and brown and black in age; No stipe Usually grow separately, rarely in clusters Hyphae system: dimitic with clamp connections. Spore print: brown. Spores: ellipsoid with thick wall (10.2 –13µm x 15–18 µm). Supposed species: Ganoderma sp. On dead wood trees Chua Chan Mountain, Dong Nai The seven mushroom strains isolated in this study are rather abundant in some fruit or rubber tree gardens, forests or foot of mountains in Southern Viet Nam. They have been gathered for food by villagers, monks, loggers, and local inhabitants but not cultivated and commercialized yet. The five strains classified into the five genera Tricholoma, Polyporus, Pleurotus, Panus and Ganoderma are common and well-recorded in Viet Nam [10, 11]. The first three genera include many valuable edible species. The other two genera, Phlebopus and Phlebia have been not well documented in Viet Nam, except few recent recordings about Nguyen Xuan Hoa, et al. 128 Phlebopus [14, 15] and Phlebia [16]. Several species of Phlebopus, such as P. spongiosus, a Vietnamese endemic species [15] and P. portentosus [17] that occur in fruit gardens, have been described as valuable edible ectomycorrhizal mushrooms. However, they can produce sporocarps in artificial cultures without host plants [15, 17] and the media for their cultivation are complex and comprised of many ingredients [17]. Species belonging genus Phlebia rarely are considered to be edible or medicinal mushrooms. However, some reports have recently mentioned about their edible or medicinal properties [18, 19]. Table 2. The similarity of the nucleotide sequences of the samples and those of species registered in GenBank Mushroom Samples Matched Species GenBank Accession Query coverage E Value Maximal Identity M2 Panus velutinus KT956126.1 97 % 7e-59 75 % M3 Phlebopus portentosus JQ623510.1 99 % 0.0 88 % M4 Tricholoma giganteum JX041888.1 100 % 0.0 91 % M7 Pleurotus giganteus (Panus giganteus) HM245785.1 98 % 0.0 94 % M8 Polyporus emerici (Favolus emerici) KM385430.1 100 % 0.0 99 % M10 Phlebia sp. KJ654588.1 98 % 0.0 93 % M20 Ganoderma subresinosum KJ654376.1 96 % 0.0 99 % 3.2. Growing mushroom mycelia on PGA and unhusked rice media Table 3. Mycelial growth rates of the strains on agar media Samples Scientific Name Growth rate of mycelium * (mm/day) PGA PGA cải tiến M20 Ganoderma sp. 7.48 b ± 0.29 9.17 a ± 0.56 M10 Phlebia sp. 7.41 b ± 0.22 4.89 c ± 0.14 M4 Tricholoma sp. 4.09 d ± 0.07 4.02 de ± 0.06 M7 Pleurotus sp. 3.68 def ± 0.22 2.96 gh ± 0.08 M8 Polyporus sp. 3.66 ef ± 0.11 3.66 ef ± 0.23 M2 Panus sp. 2.99 g ± 0.07 3.53 f ± 0.08 M3 Phlebopus sp. 1.95 i ± 0.26 2.55 h ± 0.11 * Averages ± SE followed by the same small letters in the columns do not significantly differ at P ≥ 0.05. All the strains were capable of growing on the both PGA and modified PGA media (Table 3). The M20 and M10 strains had higher growth rates (4.9–9.1 mm/day) than M4, M7, M8 and M2 strains (3.0–4.1 mm/day). The M3 showed the lowest growth on the both media. The M20 Isolation and study on pure culture of wild edible mushrooms collected from Provinces 129 took the shortest time for fully colonizing on the culture media, 5.4 and 4.4 days on the PGA and modified PGA, respectively. Most of the strains, except for M3, were capable of growing on the unhusked rice substrate (Table 4), especially M20 had the highest growth rate of spawn (7.8 mm/day), took only 13.8 days for fully colonizing on the culture substrate while the others had growth rates of 4.0 – 5.2 mm/day and took 21.2 – 27.6 days for fully colonizing the substrate. Table 4. Spawn growth on unhusked rice substrate Samples Scientific Name Growth of spawn * Growth rate (mm/day) Time for full colonization on substrate (days) M20 Ganoderma sp. 7.98 a ± 0.27 13.83 a ± 0.48 M10 Phlebia sp. 5.19 b ± 0.18 21.22 b ± 0.79 M8 Polyporus sp. 4.69 c ± 0.30 23.56 b ± 1.45 M2 Panus sp. 4.60 c ± 0.18 23.97 b ± 0.94 M7 Pleurotus sp. 4.06 d ± 0.11 27.17 c ± 0.74 M4 Tricholoma sp. 4.00 d ± 0.12 27.58 c ± 0.80 M3 Phlebopus sp. 0.0 ND * Averages ± SE followed by the same small letters in the columns do not significantly differ at P ≥ 0.05. ND, no determination. 3.3. Effects of substrates on the growth and yield of fruiting bodies Among the strains that were able to grow on the unhusked rice substrate and were therefore inoculated in culture bags for fruiting body production, the three strains M7, M10 and M4 were found to grow on all the tested media, while M20 failed to colonize on the media supplemented with corn bran of 15 % (C15), or earthworm fertilizer of 10 % (EF10) or 15 % (EF15) (Figure 2). The M7 spawn exhibited faster spreading, took only 13.3–15.0 days for fully colonizing the substrate bags, than M4 and M10 that took 22–29 days, and the M20 showed the lowest growth rate. The remaining strains M8 and M2 failed to colonize or grew very weak on all the tested substrates. The M10 gave more yields of fruiting bodies than M7 and M20 (Figures 3 & 4) although M7 formed fruiting bodies earliest. The M4 strain failed to form fruiting bodies. The results also revealed that among the media, the C5 (5% corn bran) gave mycelial growth better than the others. However, CB10, CB15 and EF5 media gave better yields of fruiting bodies in the strain M10 (Figure 3). The seven mushroom strains isolated in this study are rather abundant in some fruit or rubber tree gardens, forests or foot of mountains in Southern Viet Nam. They have been gathered for food by villagers, monks, loggers, and local inhabitants but not cultivated and commercialized yet. The five strains classified into the five genera Tricholoma, Polyporus, Pleurotus, Panus and Ganoderma are common and well-recorded in Viet Nam. The first three genera include many valuable edible species. The other two genera, Phlebopus and Phlebia have Nguyen Xuan Hoa, et al. 130 been not well- documented in Viet Nam, except few recent recordings about Phlebopus [14, 15] and Phlebia [16]. Several species of Phlebopus, such as P. spongiosus, a Vietnamese endemic species [15] and P. portentosus [17] that occur in fruit gardens, have been described as valuable edible ectomycorrhizal mushrooms. However, they can produce sporocarps in artificial cultures without host plants [15, 17] and the media for their cultivation are complex and comprised of many ingredients [17]. Species belonging genus Phlebia rarely are considered to be edible or medicinal mushrooms. However, some reports have recently mentioned about its edible or medicinal properties [18, 19]. Figure 2. Spawn growth on rubber tree sawdust supplemented with corn bran and earthworm fertilizer. CB5, CB10 and CB15, media supplemented with 5, 10, 15 % corn bran, respectively; EF5, EF10, EF15, media supplemented with 5, 10, 15 % earthworm fertilizer, respectively; Control, the medium without corn bran and earthworm fertilizer; – failed to form fruiting body Figure 3. Yield of fruiting bodies of strains on different media. CB5, CB10 and CB15, media supplemented with 5, 10, 15 % corn bran, respectively; EF5, EF10, EF15, media supplemented with 5, 10, 15 % earthworm fertilizer, respectively; Control, the medium without corn bran and earthworm fertilizer. Isolation and study on pure culture of wild edible mushrooms collected from Provinces 131 Aiming for screening the mushroom isolates easily growable on simple media, we used potatoes and glucose (in PGA or modified PGA media), unhusked-rice and rubber wood sawdust as major substrates for mycelial propagation and basidiocarp production. According to Diego (2017), sawdust, cottonseed hulls, ground corncobs, and straw supplemented with rice bran, wheat bran, corn brain, millet, corns and sorghum meal are common ingredients in mushroom cultivation [20]. The wood sawdust is more suitable for mushroom cultivation than other agricultural waste materials such as coconut leaves, banana leaves, rice straw, coconut coir dust, and bagasse [21]. In Viet Nam, rubber wood sawdust is cheap material and available since rubber wood is one the major sources of wood processing industry. Our study revealed that the mycelia of strains Phlebia M10 and Pleurotus M7 generally grew strong and fast on all tested media, especially Phlebia M10. The strain Ganoderma M20 was able to grow successfully on PGA, modified PGA, and unhusked-rice media and form fruiting bodies on rubber tree sawdust supplemented with corn bran or earthworm fertilizer at low concentrations. The high concentration of the corn bran or earthworm fertilizer in the media resulted in failure of mycelia growth and fruiting body formation of this strain. In our previous study, the corn bran at concentration of 10 % or earthworm fertilizer at concentration of 5 % supplemented in rubber wood sawdust was able to enhance production of spawn and fruiting bodies of L. squarrosulus. A study of Donini et al. (2009) on effects of different kinds of bran supplemented in elephant grass substrate on productiveness and biological efficiency of three strains of P. ostreatus indicated that the media supplemented with wheat, rice or corn bran gave higher yield than those with soybean bran [22]. The study also discussed effects of C/N ratios in supplements on the efficiency of production [22]. According to Royse [23], production of mushroom depends on the genetic nature of mushroom species, nutritional quality and structure of substrates. For example, cereal brans are sources of organic nitrogen, necessary to the mycelial growth and biological efficiency of mushrooms [22]; earthworm casting can stimulate carpophore formation of fungi, such as in Agaricus bisporus [24], and Pleurotus tuberregium [25]. Figure 4. Fruiting bodies of strains M10, M7 and M20 at immature stage The present study indicated that mycelia of the strain Phlebopus M3 was not able to form spawn on unhusked-rice. This mushroom may require a rich nutrient medium. Kumla et al. [17] purely cultured fungus Phlebopus on fungal-host agar, a synthetic medium consisting complicated mixture of many macro- and micro-element compounds and vitamins. Ji et al. [26] successfully produced fruiting bodies of Phlebopus portentosus by using non-sterilized agricultural soil-cased sawdust logs. The spawn of Polyporus M8, Panus M2 and Tricholoma M4 in our study was not capable of spreading or forming primordia on rubber sawdust substrate. They may need other suitable substrates such as, Simarouba amara, Astrocaryum aculeatum sawdust [27], or internal sheath of Bactris gasipaes [28] for Panus strigellus; oak sawdust, corn bran, rice bran, and wheat bran for Tricholoma giganteum [29]. Nguyen Xuan Hoa, et al. 132 4. CONCLUSION In this study, seven wild edible mushroom strains were isolated, purely cultivated and identified to belong to seven genera, Phlebia, Ganoderma, Tricholoma, Polyporus, Panus, Pleurotus and Phlebopus. The three strains, Phlebia sp. (M10), Ganoderma sp. (M20) and Pleurotus sp. (M7) were able to form fruiting bodies on the sawdust media supplemented corn bran or earthworm fertilizer. The sawdust media with 10 or 15 % corn bran and 5 % earthworm fertilizer showed to give better yields of fruiting bodies than the others. There is further need in finding of suitable substrates and supplements for cultivation of Tricholoma, Polyporus, Panus, and Phlebopus. Nutritional and safety assessment of these isolated strains should also be investigated before applying to mass production of the fruiting bodies. Acknowledgments. This research was supported by grant from The Department of Science and Technology (Ho Chi Minh City) to Pham Thanh Ho. REFERENCES 1. Duarte S., Pascoal C., Cassio F. and Barlocher F. - Aquatic hyphomycete diversity and identity affect leaf litter decomposition in microcosms. Oecologia 147 (2006) 658-666. 2. Mueller G. M. and Schmit J. P. - Fungal biodiversity: What do we know? What can we predict?, Biodivers Conserv 16 (1) (2007) 1–5. 3. Kirk P. M., Cannon P. F., Minter D. W. and Stalpers J. A. - Ainsworth and Bisby’s Dictionary of the Fungi (10th edition), CABI, Wallingford, UK (2008) 1–771. 4. Wasser S. P. - Medicinal mushrooms as a source of antitumor and immunomodulating polysaccharides, Appl Microbiol Biotechnol 60 (3) (2002) 258–274. 5. Muhammad B. L. and Suleiman B. - Global development of mushroom biotechnology, Int J Emerg Trends Sci Technol 2 (06) (2015) 2660–2669. 6. Okhuoya J., Akpaja E., Osemwegie O., Oghenekaro A. and Ihayere C. - Nigerian mushrooms: underutilized non-wood forest resources, JASEM 14 (1) (2010) 43–54. 7. Ray R. C. and Ward O. P. - Microbial Biotechnology in Horticulture, Science Publishers, CRC 3 (2008) 1–190. 8. Bao T. T. and Kiet T. T. - Diversity of macro fungi in Viet Nam and their resource value, Proceedings of the 1st National scientific conference of Viet Nam Natural Museum System (2011) 97–104. 9. Le B. D. - Macro Fungi in Highland Tay Nguyen Viet Nam. Natural Science and Technology Publisher (2003) 1–285, (in Vietnamese). 10. Trinh T. K. - Macrofungi of Viet Nam, Hanoi. Natural Science and Technology Publisher, 2 nd edition, Vol. 1 (2011) 1–314, (in Vietnamese). 11. Trinh T. K. - Macrofungi of Viet Nam, Hanoi: Natural Science and Technology Publisher, 2 nd edition. Vol. 2 (2012) 1–412, (in Vietnamese). 12. White T. J., Bruns T. D., Lee S. B. and Taylor J. W. - Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: PCR Protocols: A Guide to Methods and Applications, Academic Press Inc., New York (1990) 315–322. 13. Gardes M. and Bruns T. D. - ITS primers with enhanced specificity for basidiomycetes‐ application to the identification of mycorrhizae and rusts, Mol Ecol 2 (2) (1993) 113–118. Isolation and study on pure culture of wild edible mushrooms collected from Provinces 133 14. Pham N. D. H., Takahashi H., Fukiharu T., Shimizu K., Le B. D. and Suzuki A. - Phlebopus spongiosus sp. nov. (Boletales, Boletinellaceae) with a sponge-like tissue, Mycotaxon 119 (1) (2012) 27–34. 15. Pham N. D. H., Yamada A., Shimizu K., Noda K., Dang L. A. T., and Suzuki A. - A sheathing mycorrhiza between the tropical bolete Phlebopus spongiosus and Citrus maxima, Mycoscience 53 (5) (2012) 347–353. 16. Nakasone K. K. - Mycoaciella, A synonym of Phlebia, Mycotaxon Vol. LXXXI (2002) 477–490. 17. Kumla J., Hobbie E. A., Suwannarach N. and Lumyong S. - The ectomycorrhizal status of a tropical black bolete, Phlebopus portentosus, assessed using mycorrhizal synthesis and isotopic analysis, Mycorrhiza 26 (4) (2016) 333–343. 18. Hai B. T., Suhara H., Doi K., Ishikawa H., Fukami K., Parajuli G. P., Katakura Y., Yamashita S., Watanabe K., Adhikari M. K., Manandhar H. K., Kondo R. and Shimizu K. - Wild mushrooms in Nepal: some potential candidates as antioxidant and ACE-inhibition sources, eCAM (2014) 1–11. 19. Arko P. F., Marzuki B.M. and Kusmora J. - The inventory of edible mushroom in Kamojang Nature Reserve and Nature Park, West Java, Indonesia. Biodiversitas 18 (2017) 530–540. 20. Diego C. Z. and Pardo-Giménez A. (eds). - Edible and Medicinal Mushrooms. Technology and Applications. John Wiley & Sons, Ltd., Chichester, UK (2017) 1–312. 21. Ediriweera S. S., Wijesundera R. L. C., Nanayakkara C. M. and Weerasena O. V. D. S. J. - Comparative study of growth and yield of edible mushrooms, Schizophyllum commune Fr., Auricularia polytricha (Mont.) Sacc. and Lentinus squarrosulus Mont. on lignocellulosic substrates. Mycosphere 6 (6) (2015) 760–765. 22. Donini L. P., Bernardi E., Minotto E. and Do Nascimento J. S. Cultivation of shimejii on elephant grass substrate supplemented with different kinds of bran. Scientia Agraria 10 (1) (2009) 067–074. 23. Royse D. J. - Influence of spawn rate and commercial delayed release nutrient levels on Pleurotus cornucopiae (oyster mushroom) yield, size, and time to production. Appl Microbiol Biotechnol 58 (4) (2002) 527–531. 24. Grappelli A., Galli E. and Tomati U. - Earthworm casting effect on Agaricus bisporus fructification. Agrochimica Vol. XXXI (4-5) (1987) 457–462. 25. Omowumi I. O. and Kadiri M. - The Use of Earthworm Cast as a Casing Material, Time of Application and Substrate size on Yield of Pleurotus tuberregium (Fr.) Singer, a Nigerian Mushroom. Nature Sci 11 (4) (2013) 4–8. 26. Ji K. P., Cao Y., Zhang C. X., He M. X., Liu J., Wang W. B. and WangY. - Cultivation of Phlebopus portentosus, in southern China. Mycol Prog 10 (2011) 293–300. 27. Vargas-Isla R., Hanada R. E. and Ishikawa N. K. - Sawdust and fruit residues of Central Amazonian for Panus strigellus spawn’s production. Pesq Flor Bras 32 (70) (2012) 123- 128. 28. Vargas-Isla R., Yuyama L. K. O., Aguiar J. P. L. and Ishikawa N. K. - Production of Panus strigellus spawn using the internal sheath of peach palm (Bactris gasipaes) as a substrate. Interciencia 38 (10) (2013) 733–736. 29. Yoshikazy M. and Mizuno T. (1997). - Cultivation of Niohshimeji (Tricholoma giganteum). Food Rev Int 13 (3) (1997) 413–418.

Các file đính kèm theo tài liệu này:

  • pdf12389_103810384591_1_pb_463_2061124.pdf
Tài liệu liên quan