Định danh và nghiên cứu một số yếu tố ảnh hưởng lên khả năng sinh tổng hợp protease ngoại bào của bacillus subtilis DC5 - Đỗ Thị Bích Thủy

SUMMARY The strain Bacilus subtilis DC5 having high productivity of extracellular amylase and protease was determined as based on its 16S rDNA gene sequence. Cultivating strain B. subtilis DC5 in optimum basic medium supplemented with soluble starch or yeast extract increased protease productivity (0.423 HP/ml and 0.528 HP/ml, respectively). However, protease productivity of this strain was not increased in case combination of these nitrogen and carbon sources in the culture medium. The highest protease activity was 0.649 HP/ml when cultivating the strain in medium containing 0.75% soluble starch. Study on effect of physical conditions indicated that protease activity of B. subtilis DC5 was obtained at the highest when cultivated at initial pH 7, temperature of 35oC after 22 hours of cultivation.

doc7 trang | Chia sẻ: thucuc2301 | Lượt xem: 474 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Định danh và nghiên cứu một số yếu tố ảnh hưởng lên khả năng sinh tổng hợp protease ngoại bào của bacillus subtilis DC5 - Đỗ Thị Bích Thủy, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ĐỊNH DANH VÀ NGHIÊN CỨU MỘT SỐ YẾU TỐ ẢNH HƯỞNG LÊN KHẢ NĂNG SINH TỔNG HỢP PROTEASE NGOẠI BÀO CỦA Bacillus subtilis DC5 Đỗ Thị Bích Thủy*, Phan Thị Bé, Đoàn Thị Thanh Thảo TAP CHI SINH HOC 2015, 37(1se): 177-183 DOI: 10.15625/0866-7160/v37n1se. Trường Đại học Nông Lâm Huế, *dothibichthuy@huaf.edu.vn TÓM TẮT: Chủng Bacillus subtilis DC5 có khả năng sinh tổng hợp amylase và protease ngoại bào cao được định danh bằng phương pháp giải trình tự gene 16S rDNA. Hoạt độ protease trong môi trường nuôi cấy chủng này trong môi trường có tinh bột (0,423 HP/ml) cao hơn so với các nguồn cacbon khác. Cao nấm là nguồn ni tơ thích hợp nhất để chủng này sinh protease cao so với các nguồn nitơ khác, hoạt tính đạt 0,528 HP/ml. Kết quả khảo sát kết hợp bổ sung các nguồn cacbon và nitơ đều không cao hơn so với việc bổ sung riêng rẻ nguồn tinh bột và cao nấm. Hoạt độ protease đạt cao nhất (0,649 HP/ml) khi môi trường nuôi cấy có 0,75% tinh bột. Chủng B. subtilis DC5 có khả năng sinh protease cao nhất khi nuôi cấy ở môi trường có pH ban đầu là 7,0; nhiệt độ 35oC trong môi trường thích hợp. Thời gian thu nhận enzyme tốt nhất sau 22 giờ nuôi cấy. Từ khóa: Bacillus subtilis DC5, hoạt độ protease, protease ngoại bào, sinh tổng hợp amylase. MỞ ĐẦU Protease chiếm 2/3 lượng enzyme sử dụng trong các ngành công nghiệp khác nhau. Enzyme này có ứng dụng rộng rãi trong nhiều lĩnh vực, đặc biệt là trong công nghiệp thực phẩm [2] và công nghiệp y dược [3, 5]. Do nhu cầu ngày càng tăng, việc nghiên cứu sản xuất enzyme công nghiệp này đang trở nên rất cần thiết. Người ta có thể thu nhận protease từ nhiều nguồn khác nhau, trong đó, vi sinh vật là đối tượng chính để sản xuất enzyme nói chung và protease nói riêng với số lượng nhiều và giá thành rẻ. Những kết quả đạt được trong lĩnh vực nghiên cứu về protease vi sinh vật chủ yếu tập trung vào Bacillus sp. [9,10]. Với mục đích góp phần vào việc khai thác các chế phẩm enzyme từ vi sinh vật, trong công trình này, chúng tôi đã tuyển chọn chủng B. subtilis DC5 có khả năng sinh protease ngoại bào cao và xác định điều kiện thích hợp để chủng này sinh tổng hợp protease ngoại bào cao nhất. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Vật liệu nghiên cứu là chủng DC5 được tuyển chọn từ các chủng vi khuẩn phân lập từ dưa cải. Các hợp chất sử dụng làm môi trường như pepton, cao thịt, cao nấm men, tinh bột, glucose được cung cấp bởi hãng Merk, Đức. Phân tích trình tự gen 16S rDNA Tách DNA tổng số của vi khuẩn: dịch huyền phù vi khuẩn được cho vào ống Eppendorf 1,5ml đã có sẵn 200 μl dung dịch InstageneTM MaxTrix (Bio-rad), lắc đều (vortex) trong 10 giây và sau đó ly tâm (spin down), ủ ở 56oC trong 30 phút, sau đó, lắc đều mẫu trong 10 giây và đun sôi ở 100oC trong 8 phút, rồi ủ trong nước đá trong 5 phút. Hỗn hợp tiếp tục được ly tâm ở 13.200 vòng/phút trong 5 phút và pha loãng 10 lần dịch nổi thu được để thực hiện phản ứng PCR. Tách dòng và giải trình tự gen 16S rDNA: dịch DNA của vi khuẩn sau khi tách chiết (5μl) được cho vào 20 μl hỗn hợp PCR (NK16S-PCR) (Công ty Nam Khoa, Thành Phố Hồ Chí Minh) và thực hiện phản ứng PCR, theo chu trình nhiệt như sau: 1 chu kỳ 95oC trong 10 phút; 40 chu kỳ gồm các giai đoạn: 94oC trong 30 giây, 60oC trong 30 giây, 72oC trong 1 phút và 1 chu kỳ 72oC trong 10 phút. Kiểm tra sản phẩm PCR bằng phương pháp điện di trên gel agarose 2%. Sản phẩm PCR có độ dài khoảng 0,5 kb được tinh sạch và giải trình tự trên hệ thống ABI 3130XL (Applied Biosystems, Hoa Kỳ). Phương pháp nuôi cấy để thu nhận enzyme Chủng vi khuẩn được nuôi cấy trong môi trường lỏng, lắc 200 vòng/phút ở 35oC trong 24 giờ. Dịch môi trường nuôi cấy có chứa enzyme được thu nhận bằng cách ly tâm tách tế bào ở 14000 vòng/phút, nhiệt độ 4oC, 10 phút. Xác định hoạt độ protease bằng phương pháp Anson cải tiến [6] Hỗn hợp phản ứng thủy phân gồm dung dịch enzyme và dung dịch casein 2,0%, tỷ lệ 1:2 (v/v) được ủ ở 30oC, 10 phút; ngưng phản ứng bằng dung dịch tricloacetic acid (TCA) 5,0% theo tỷ lệ 5 thể tích dung dịch acid cho 1 thể tích enzyme; ly tâm thu dịch nổi để thực hiện phản ứng tạo màu với thuốc thử Folin 0,2N có mặt Na2CO3 6% (tỷ lệ dịch nổi: dung dịch Na2CO3: Folin 0,2N = 1:4:1). Thực hiện đồng thời mẫu kiểm tra bằng cách cho dung dịch TCA vào enzyme trước khi ủ với cơ chất. Độ hấp thụ ánh sáng (OD) của dung dịch màu thu được sau phản ứng được xác định ở bước sóng 750nm. Dựa vào đồ thị chuẩn tyrosine, để tính sản phẩm tạo thành tương ứng dưới tác dụng của enzyme. Một đơn vị hoạt độ proteinase (HP) được định nghĩa là lượng enzyme mà trong một phút ở 30oC có khả năng phân giải protein tạo thành các sản phẩm hoà tan trong tricloacetic acid, cho phản ứng màu tương đương với 1,0 µmol tyrosine. Nghiên cứu ảnh hưởng của thành phần môi trường nuôi cấy, pH và nhiệt độ lên khả năng sinh tổng hợp protease ngoại bào bởi B. subtilis DC5 và xác định thời gian thu nhận enzyme thích hợp. Ban đầu, thí nghiệm được thực hiện bằng cách nuôi cấy B. subtilis DC5 trong môi trường cơ bản (MTCB) có bổ sung nguồn C (tinh bột hòa tan, lactose, maltose, glucose, saccharose) và nguồn N (NH4Cl, NH4NO3, (NH4)2SO4, casein, cao nấm men). Sau đó, tiến hành phối hợp nguồn C và N để chọn ra thành phần môi trường thích hợp cho hoạt độ protease cao nhất. Tiếp theo, B. subtilis DC5 được nuôi cấy trong môi trường thích hợp nhất để chủng này sinh tổng hợp protease ngoại bào cao với pH ban đầu thay đổi từ 5 đến 11. Cuối cùng, chủng này được nuôi cấy trong môi trường và pH thích hợp với các mức nhiệt độ 30oC, 40oC, 50oC và 60oC để xác định nhiệt độ thích hợp. Để chọn thời gian nuôi cấy thích hợp nhằm thu được protease ngoại bào nhiều nhất, B. subtilis DC5 được nuôi cấy trong điều kiện thích hợp về môi trường, pH ban đầu và nhiệt độ và xác định hoạt độ protease trong môi trường trong các khoảng thời gian nuôi cấy từ 8 giờ đến 96 giờ. Phương pháp xử lý số liệu Số liệu thí nghiệm được xử lý thống kê bằng phần mềm SPSS. KẾT QUẢ VÀ THẢO LUẬN Định danh chủng vi khuẩn DC5 Chủng vi khuẩn DC5 thể hiện hoạt tính protease và amylase ngoại bào cao (hình 1) đã được định danh bằng phương pháp phân tích trình tự gene 16S rDNA và khảo sát các yếu tố ảnh hưởng đến khả năng sinh tổng hợp protease ngoại bào. Đối chiếu trình tự 16S rDNA của chủng DC5 (hình 2) với trình tự gen của một số chủng Bacillus subtilis như MA4, AYC3, NBT-15 cho thấy mức độ tương đồng đến 99%. Do đó, chúng tôi xác định chủng DC5 thuộc loài B. subtilis. a b CGCGGGCTGCTGGCACGTAGTTAGCCGTGGC TTTCTGGTTAGGTACCGTCAGGTGCCGCCCT ATTTGAACGGCACTTGTTCTTCCCTAACAACA GAGCTTTACGATCCGAAAACCTTCATCACTCA CGCGGCGTTGCTCCGTCAGACTTTCGTCCATT GCGGAAGATTCCCTACTGCTGCCTCCCGTAGG AGTCTGGGCCGTGTCTCAGTCCCAGTGTGGC CGATCACCCTCTCAGGTCGGCTACGCATCGTCG CCTTGGTGAGCCGTTACCTCACCAACTAGCTAA TGCGCCGCGGGTCCATCTGTAAGTGGTAGCCGA AGCCACCTTTTATGTCTGA Hình 1. Vòng thủy phân protease (a) và amylase (b) của chủng DC5 Hình 2. Trình tự gen 16S DNA của chủng B. subtilis DC5 Nguồn cacbon thích hợp cho sinh protease ngoại bào của B. subtilis DC5 Trong các nguồn cacbon, tinh bột tan có khả năng kích thích B. subtilis DC5 sinh tổng hợpprotease ngoại bào cao nhất (0,514 HP/ml) (MT5) (hình 3). Kết quả này phù hợp với công bố của Joo et al. (2002) [8]. Trong MT1 có mặt glucose gây ức chế ngược làm giảm khả năng sinh tổng hợp protease, hoạt độ đạt được thấp nhất (0,059 HP/ml). Đối với các chủng có khả Hoạt độ HP/ml Môi trường Môi trường Hoạt độ HP/ml năng sinh tổng hợp protease ngoại bào mạnh khi có mặt tinh bột trong môi trường, protease ngoại bào của nó thiếu tính đặc hiệu tuyệt đối. Hình 3. Ảnh hưởng của nguồn carbon đến khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 ĐC: MTCB; MT1: ĐC+glucose 0,5%; MT2: ĐC+saccharose 0,5%; MT3: ĐC+maltose 0,5%; MT4: ĐC+lactose 0,5%; MT5: ĐC +tinh bột tan 0,5%. Hình 4. Ảnh hưởng của nguồn nitơ đến khả năng sinh tổng hợp protease ngoại bào của chủng Bacillus subtilis DC5 ĐC: MTCB; MT6: ĐC+casein 0,5%; MT7: ĐC+NH4Cl 0,5%; MT8: ĐC+NH4NO3 0,5%; MT9: ĐC+(NH4)2SO4 0,5%; MT10: ĐC+ cao nấm men 0,5%. Nguồn nitơ thích hợp cho sinh protease ngoại bào của B. subtilis DC5 Trong các nguồn nitơ đã được khảo sát, khả năng kích thích quá trình sinh protease bởi chủng B.subtilis DC5 của nguồn nitơ hữu cơ tốt hơn nguồn vô cơ, mạnh nhất là cao nấm men (0,528 HP/ml) (hình 4). Kết quả trên phù hợp với nghiên cứu của Đỗ Thị Bích Thủy & Trần Thị Xô (2004) [12], Sangeetha et al. (2008) [11]. Trong khi đó, Agrebi et al. (2009) [1], Mussarat et al. (2008) [9] cho rằng casein là nguồn nitơ kích thích khả năng sinh tổng hợp protease. Khi bổ sung phối trộn các nguồn carbon và nitơ vào MTCB có chứa 1% peptone, 0,3% cao thịt và 0,5% NaCl, hoạt độ protease trong môi trường nuôi cấy không cao hơn so với chỉ bổ sung tinh bột. Vì vậy, ảnh hưởng của hàm lượng tinh bột lên khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 được tiếp tục khảo sát. Hàm lượng tinh bột thích hợp cho sinh protease ngoại bào của B. subtilis DC5. Hàm lượng tinh bột 0,75% được bổ sung vào MTCB cho hoạt độ protease (0,649 HP/ml) cao hơn so với các hàm lượng khác (0,25; 0,5; 1; 1,25; 1,5; 1,75%) (hình 5). MTCB có bổ sung 0,75% tinh bột tan được gọi là môi trường bổ sung tinh bột. Với các môi trường có hàm lượng tinh bột tan nhỏ hơn 0,75%, hoạt độ protease thấp hơn có lẽ là do tinh bột chưa đủ nhiều để kích thích quá trình sinh tổng hợp protease ngoại bào. Trường hợp hàm lượng tinh bột trong môi trường cao hơn 0,75% làm cho độ nhớt môi trường lớn hơn nên phần nào làm cho vi khuẩn khó tiếp xúc với các thành phần khác của môi trường làm kìm hãm một phần khả năng sinh tổng hợp protease. Hoạt độ HP/ml Nhiệt độ (oC) Hình 5. Ảnh hưởng của hàm lượng tinh bột đến khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 Nhiệt độ (oC) Hoạt độ HP/ml MT5: ĐC + Tinh bột 0,5%; MT20: ĐC + Tinh bột 0,25%; MT21: ĐC + Tinh bột 0,75%; MT22: ĐC + Tinh bột 1%; MT23: ĐC + Tinh bột 1,25%; MT24: ĐC + Tinh bột 1,5%; MT25: ĐC + Tinh bột 1,75%. Hình 6. Ảnh hưởng của nhiệt độ đến khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 Ảnh hưởng của pH ban đầu của môi trường cho sinh protease ngoại bào của chủng B. subtilis DC5 Chủng B. subtitis DC5 có khả năng sinh protease cao nhất (0,699 HP/ml) khi nuôi cấy trong môi trường bổ sung tinh bột với pH ban đầu là 7 (hình 6). Hoạt độ protease đạt được khi nuôi cấy trong cùng môi trường với pH 5 và pH 6 đạt được khá cao. Kết quả này tương tự như kết quả mà Ghafoor & Shahida (2008) [7], Yong et al. (2003) [14] đã nghiên cứu. Một số công bố cho thấy điều kiện pH 7,5, pH 8,0 và pH 10 thích hợp cho các chủng thuộc loài B. subtilis sinh tổng hợp protease ngoại bào cao [4, 13, 9]. Ảnh hưởng của nhiệt độ lên khả năng sinh protease ngoại bào của chủng B. subtilis DC5. Khả năng sinh tổng hợp protease ngoại bào của chủng B. subtitis DC5 cao nhất khi nuôi cấy ở nhiệt độ 35oC, hoạt độ đạt được là 0,7 HP/ml (hình 7). Ở khoảng nhiệt độ 45oC - 60oC, khả năng sinh enzyme của B. subtitis DC5 giảm mạnh. Rai & Ashis (2010) [10] cho thấy, nhiệt độ thích hợp cho sinh tổng hợp protease của chủng B. subtilis DM-04 là 37 - 45oC, Mussarat et al. (2008) [9] công bố rằng ở nhiệt độ 50oC khả năng sinh enzyme protease của B. subtilis BS1 mạnh nhất. Khảo sát thời gian thích hợp để thu protease ngoại bào của B. subtilis DC5 Hoạt độ protease trong môi trường tăng nhanh và đạt cực đại sau khi nuôi cấy 24 giờ, (0,697 HP/ml) sau đó giảm dần. Ở 80, 88, 96 giờ chủng này không còn khả năng sinh enzyme (hình 8). Để kết quả được chính xác hơn, chúng tôi tiến hành khảo sát quá trình sinh enzyme trong khoảng thời gian từ 8 giờ đến 34 giờ, 2 giờ nuôi cấy lấy mẫu 1 lần. Sau 22 giờ nuôi cấy, hoạt độ protease trong môi trường cao nhất (0,714 HP/ml). Sangeetha et al. (2008) [11] nghiên cứu trên B. subtilis SG2 cho thấy ở 36 giờ chủng này sinh protease mạnh nhất. Hoạt độ HP/ml pH Hoạt độ HP/ml Thời gian (giờ) Hình 7. Ảnh hưởng pH ban đầu của môi trường đến khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 Hình 8. Ảnh hưởng của thời gian nuôi cấy đến khả năng sinh tổng hợp protease ngoại bào của chủng B. subtilis DC5 KẾT LUẬN Chủng Bacillus subtilis DC5 được phân lập từ dưa cải là chủng có khả năng tổng hợp protease ngoại bào cao. Chủng này sinh tổng hợp protease ngoại bào cao nhất khi nuôi cấy trên môi trường có chứa pepton 1%; cao thịt 0,3%; tinh bột tan 0,75% và NaCl 0,5%; ở pH ban đầu bằng 7; nhiệt độ nuôi cấy là 35oC, trong thời gian 22 giờ. TÀI LIỆU THAM KHẢO Agrebi R., Noomen H., Mohamed H., Nawrez K., Anissa H., Nahed F.Z., Moncef N., 2009. Fibrinolytic serine protease isolation from Bacillus amyloliquefaciens An6 grown on mirabilis jalapa tuber powders. Appl Biochem Biotechnol, 162(1): 75-88. Annalisa C., Rossella D. M., Silvana C., Fidel T., Danilo E., Francesco V., 2007. Proteolytic and lipolytic starter cultures and their effect on traditional fermented sausages ripening and sensory traits. Food Microbiol, 25: 335-348. Brice K., Thierry M., Francis G., 2007. Neutrophil elastase, proteinase 3 and cathepsin G: Physicochemical properties, activity and physiopathological functions. Biochimie, 90: 227-242. Deepak V., Kalishwaralal K., Ramkumarpandian S., Babu S. V., Senthilkumar S. R., Sangiliyandi G., 2008. Optimization of media composition for Nattokinase production by Bacillus subtilis using response surface methodology. Bioresour Technol, 99(17): 8170-8174. Fernandez L., Lopez L. R., Secades P., Menendez A., Marquez I., Guijarro J. A., 2003. In vitro and in vivo studies of the Yrp1 protease from Yersinia ruckeri and its role in protective immunity against enteric red mouth disease of salmonids. Appl and Environ Microbiol, 69(12): 7328-7335. Folin O., Ciocatteu V., 1927. On tyrosine and tryptophan determination in proteins. Journal of Biological Chemistry, 73: 627-650. Ghafoor A., Shahida H., 2009. Production dynamics Bacillus subtilis strains AG-1 and EAG-2, producing an extracellular alkaline protease. Afr J of Microbiol Res, 3(5): 258-263. Joo H. S., Kumar C. G., Park G. C., Kim K. T., Paik S. R., Chang C. S., 2002. Optimization of the production of an extracellular alkaline proteinase from Bacillus horikoshi. Process Biochem, 38: 155-159. Mussarat S., Aamer A.S., Abdul H., Fariha H., 2008. Influence of culture condition on production and activity of protease from Bacillus subtilis BS1. Parkistan J of Microbiol, 40(5): 2161-2169. Rai S. K., Ashis K. M., 2010. Statistical optimization of production, purification and industrial application of a laundry detergent and organic solvent-stable subtilisin-like serine protease (Alzwiprase) from Bacillus subtilis DM-04. Biochem Eng J, 48(2): 173-180. Sangeetha, Phil M., Geetha, Arulpandi, 2008. Optimization of protease and lipase production by Bacillus pumilus SG 2 isolated from an industrial effluent. The Internet J of Microbiol, 5(2). Đỗ Thị Bích Thủy, Trần Thi Xô, 2004. Nghiên cứu ảnh hưởng của một số yếu tố lên khả năng sinh protease của Bacillus subtilis. Tạp chí Nông nghiệp và Phát triển nông thôn, Số 12/2004: 1667-1668. Wang S. H., Cheng Z., Yan L. Y., Miao D., Ming F. B., 2008. Screening of a high fibrinolytic enzyme producing strain and characterization of the fibrinolytic enzyme produced from Bacillus subtilis LD-8547. World J Microbiol Biotechnol, 24: 475-482. Yong J. K., Kim J. H., Gal S. W., Kim J. E., Park S. S., Chung K. T., Kim Y. H., Kim B. W., Joo W. H., 2003. Molecular cloning and characterization of the gene encoding a fibrinolytic enzyme from Bacillus subtilis strain A1. World J of Microbiol and Biotechnol, 20: 711-717. OPTIMIZATION OF GROWTH CONDITIONS AND PRODUCTION OF EXTRACELLULAR PROTEASE BY Bacillus subtilis DC5 Do Thi Bich Thuy, Phan Thi Be, Doan Thi Thanh Thao Hue University of Agriculture and Forestry SUMMARY The strain Bacilus subtilis DC5 having high productivity of extracellular amylase and protease was determined as based on its 16S rDNA gene sequence. Cultivating strain B. subtilis DC5 in optimum basic medium supplemented with soluble starch or yeast extract increased protease productivity (0.423 HP/ml and 0.528 HP/ml, respectively). However, protease productivity of this strain was not increased in case combination of these nitrogen and carbon sources in the culture medium. The highest protease activity was 0.649 HP/ml when cultivating the strain in medium containing 0.75% soluble starch. Study on effect of physical conditions indicated that protease activity of B. subtilis DC5 was obtained at the highest when cultivated at initial pH 7, temperature of 35oC after 22 hours of cultivation. Keywords: Bacillus subtilis DC5, extracellular protease, protease productivity. Ngày nhận bài: 22-10-2014

Các file đính kèm theo tài liệu này:

  • doc6107_22171_1_pb_4156_0545_2017999.doc