Characteristics of the cystatin gene in some Vietnamese mungbean cultivars (Vigna radiata (L.) willzek)

We were isolated cystatin genes from mungbean cultivars (Vigna radiata L. Wilczek) which PCR analysis using one primer pair (CysF, CysR). PCR products containing the cystatin fragment was cloned in pTZ57R/T and sepuenced. The cloned cystatin gene of four mungbean cultivars (KP11, KPS1, MN93 và 263) had 1115 nucleotides in length, including 2 exons (1- 75 and 923-1115) and 1 intron. The coding region of cystatin genes comprises of 267 nucleotides which encode a polypeptide of 88 amino acid residues. Nucleotide sequence of cystatin gene in the four mungbean cultivars (KP11, KPS1, MN93 and 263) have a high level of similarity (99.6% - 99.8%), without a change in the 2 exons, but there are 6 the single nucleotide polymorphism located in the introns.

pdf8 trang | Chia sẻ: yendt2356 | Lượt xem: 916 | Lượt tải: 1Freedownload
Bạn đang xem nội dung tài liệu Characteristics of the cystatin gene in some Vietnamese mungbean cultivars (Vigna radiata (L.) willzek), để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 79 CHARACTERISTICS OF THE CYSTATIN GENE IN SOME VIETNAMESE MUNGBEAN CULTIVARS (Vigna radiata (L.) Willzek) Nguyen Vu Thanh Thanh 1 , Chu Hoang Mau 2 * 1 Department of Genetics, Faculty of Life Science, College of Science-TNU 2 Department of Genetics and Modern Biology, Faculty of Bilogy and Agro-Technic, College of Education-TNU SUMMARY Cystatins are inhibitors of cystein proteases belonging to papain family. In plants, cystatins are found to be involved in drought stress. This paper our finding about the genes encoding cystatins isolated from Vietnam mungbean cultivars (Vigna radiata L. Wilczek) with different level of drought tolerance. Genomic DNA of four mungbean cultivars, including two with high drought tolerance (KP11 and KPS1) and two with low drought tolerance (MN93, 263) are isolation for gene cloning using cystatin specific primers. Sequencing data of the four cloned cystatin gene fragments proved to be that of cystatin gene with a length of 1115 nucleotides, deviding into 2 exons and 1 intron. The PRF of coding regions of cystatin gene comprises of 267 nucleotides with encoding a polypeptide of 88 amino acids. The nucleotide sequences of the four cultivars show variations in different sites although the amino acid sequences do not differ each to other and even to that announced under the code AF454396. Possible regulatory differences are discussed in relation to the variation found in intron region. Nucleotide sequence of cystatin gene in the four mungbean cultivars (KP11, KPS1, MN93 and 263) have a high level of similarity (99.6% - 99.8%), without a change in the 2 exons, but there are 6 the single nucleotide polymorphism located in the introns. Comparision of the amino acid sequences of genes encoding cystatin in mungbean cultivars (KP11, KPS1, MN93, 263) with one mungbean cultivar on NCBI (AF454396), results shows that amino acid sequences was 100% homologous. The result obtained suggests that need further research on the role of control active of intron regions When the mungbean cultivars live In drought conditions. Keywords: cystatin gene, drought stress, inhibitors, mungbean, Vigra radiata INTRODUCTION * Mungbean [Vigna radiata (L.) Wilczek] is a grain legume widely grown in the tropics and subtropics and is an excellent source of dietary protein. The yields of mungbean are affected by various biotic and abiotic stresses such as diseases, insect pests and water stresess. In Viet Nam drought is one of the most important barriers limiting mungbean acreage and yield. Breeding works have been focused on improvement of drought tolerance and resulted in various cultivars with a range of drought toelrance level. The mechanisms of drought tolerance is yet not sufficiently understood. One of the postulated mechanism for increasing the drought tolerance is the * Tel: 0913.383.289; Email: [email protected] increasing of cysteine activities. Cysteine proteases are involved in signalling pathways and in the response to biotic and abiotic stresses. Most plant cysteine proteases belong to the papain (C1) and legumain (C13) families. Cystatins are inhibitors of cysteine proteases, widely distributed in plant kingdom (Filho et al., 1992; Oliveira et al., 2003; Turk et al., 1991). Cystatin genes of Vigna unguiculata L., Glycine max L., Daucus carota L., Malus domestica (Diop et al., 2004; Misaka et al., 1996; Ọima et al., 1997; Ryan et al., 2003) have been isolated and well characterized. In this report, we present results in characterization of cystatin gene isolated from four mungbean cultivars which are different in tolerance ability to drought: KP11and KPS1 are drought tolerant and MN93 and 263 are drought sensitive. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 80 MATERIALS AND METHODS Materials: Four mungbean cultivars (KP11, KPS1, MN93, 263) provided by the Legume R/D Center of VAAS. According to our test results KP11 and KPS1 are drought tolerance and MN93 and 263 are drought sensitive. One specific primer pair, including: CysF: 5’gtcgcaggaactagaaagcgttg 3’ CysR: 5’ctatgcaggtgcctctccaac 3’ Cloning pTZ57R/T vectors. Both primers and vector are supplied by Fermentas company. Methods: Total DNA is separated from leaf of four mungbean cultivars following the method of Gawel and Jarnet (1991) with modifications (Gawel et al., 1991). PCR is performed in a total volume of 50 l. PCR conditions are: an initial denaturation step of 94 0 C for 3 min, followed by 30 cycles of 94 0 C for 30 sec, 56 0 C for 1 min and 72 0 C for 1 min. The final extension step is 72 0 C for 10 min. The PCR products are checked by 1% agarose gel electrophoresis. PCR products are cloned into pTZ57R/T. Sequencing was completed using ABI3100. Data analysis was performed by using molecular biology softwares. RESULTS AND DISCUSSIONS Cloning of cystatin genes from mungbean cultivars To isolate gene encoding cystatin in genome of mungbean cultivars, we segregated the DNA total. DNA samples are diluted at The DNA concentration of 50 ng of all sample was suitable to amplify the cystatin gene fragments. There are no visual difference in the size of PCR products of all DNA sources from four cultivars, the size of the PCR product expected to be around 1.1 kb (fig 1). Kang et al (2001) submitted a sequence of cystatin gene isolated from mRNA with the size of only 304 nucleotides because of lacking the intron region, which appears in our PCR product using genomic DNAs. To determine gene sequence, the PCR products were iserted into the cloning vector pTZ57R/T and transformed into E.coli strain DH5α and selected by blue/white technique. Plasmids were purified by QIAprep Spin Miniprep for sequencing by ABI 3100 using forward and reverse primers. Fig 1. PCR products amplified using cystatin genes specific primers and genomic DNA samples of KP11, MN93, 263 and KPS1 mungbean cultivars. M: Marker 1kb; lane 1. KP11; 2. MN93; 3. 263; 4. KPS1 Nucletide sequences of cloned cystatin genes Totally, there 1115 nucleotides have been read. The nucleotide sequences are almost similar each to other. Only six single nucleotide polymorphisms could be registed at the positions of 287, 497, 561, 706, 870 and 907(fig. 2). Interesting to note that all nucleotide variations occure in the intron region, not in the coding exons. The nucleotide similarity comparison revealed the two drought tolerant cultivars is clustering in one group (with 99.7% similarity) and the two drought sensitive cultivars in another group (with 99.7% similarity) (fig 2).  1.1kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 81 ....| ....|....|....|....|....| ....|....|....|....| 10 20 30 40 50 KPS1 ATGTCGCAGG AACTAGAAAG CGTTGAGATC GATAGTTTAG CTCGATTTGC MN93 ATGTCGCAGG AACTAGAAAG CGTTGAGATC GATAGTTTAG CTCGATTTGC 263 ATGTCGCAGG AACTAGAAAG CGTTGAGATC GATAGTTTAG CTCGATTTGC KP11 ATGTCGCAGG AACTAGAAAG CGTTGAGATC GATAGTTTAG CTCGATTTGC ....|....| ....|....| ....|....| ....|....| ....|....| 60 70 80 90 100 KPS1 TGTTGAAGAA CACAACAAAA AACAGGTTTT TCTTTTTCCT TTCACACACC MN93 TGTTGAAGAA CACAACAAAA AACAGGTTTT TCTTTTTCCT TTCACACACC 263 TGTTGAAGAA CACAACAAAA AACAGGTTTT TCTTTTTCCT TTCACACACC KP11 TGTTGAAGAA CACAACAAAA AACAGGTTTT TCTTTTTCCT TTCACACACC ....|....| ....|....| ....|....| ....|....| ....|....| 110 120 130 140 150 KPS1 CTTTATTTTT TTTTCCCTTC AAAAAGATTA AAGAAATTTG TACCACTCAT MN93 CTTTATTTTT TTTTCCCTTC AAAAAGATTA AAGAAATTTG TACCACTCAT 263 CTTTATTTTT TTTTCCCTTC AAAAAGATTA AAGAAATTTG TACCACTCAT KP11 CTTTATTTTT TTTTCCCTTC AAAAAGATTA AAGAAATTTG TACCACTCAT ....|....| ....|....| ....|....| ....|....| ....|....| 160 170 180 190 200 KPS1 TATGTTTTGC TCTGTATCTT ATGCTTCTCG AGAAATTCCC AAGCTTTCTG MN93 TATGTTTTGC TCTGTATCTT ATGCTTCTCG AGAAATTCCC AAGCTTTCTG 263 TATGTTTTGC TCTGTATCTT ATGCTTCTCG AGAAATTCCC AAGCTTTCTG KP11 TATGTTTTGC TCTGTATCTT ATGCTTCTCG AGAAATTCCC AAGCTTTCTG ....|....| ....|....| ....|....| ....|....| ....|....| 210 220 230 240 250 KPS1 TTGGTTTCCT ATTGGGTCTG ATCGTTGATC GGTTTCGGCC ACGCCAAGAT MN93 TTGGTTTCCT ATTGGGTCTG ATCGTTGATC GGTTTCGGCC ACGCCAAGAT 263 TTGGTTTCCT ATTGGGTCTG ATCGTTGATC GGTTTCGGCC ACGCCAAGAT KP11 TTGGTTTCCT ATTGGGTCTG ATCGTTGATC GGTTTCGGCC ACGCCAAGAT ....|....| ....|....| ....|....| ....|....| ....|....| 260 270 280 290 300 KPS1 TTCTTCAGAG ATTCACATGT TTGATTATAT TATCTCTTTT GTTTGATTAA MN93 TTCTTCAGAG ATTCACATGT TTGATTATAT TATCTCCTTT GTTTGATTAA 263 TTCTTCAGAG ATTCACATGT TTGATTATAT TATCTCTTTT GTTTGATTAA KP11 TTCTTCAGAG ATTCACATGT TTGATTATAT TATCTCTTTT GTTTGATTAA ....|....| ....|....| ....|....| ....|....| ....|....| 310 320 330 340 350 KPS1 CAATAATTGT TAACTTTTAG ATTTTTCTTC TGGGGATAAT GGGGTTCTTC MN93 CAATAATTGT TAACTTTTAG ATTTTTCTTC TGGGGATAAT GGGGTTCTTC 263 CAATAATTGT TAACTTTTAG ATTTTTCTTC TGGGGATAAT GGGGTTCTTC KP11 CAATAATTGT TAACTTTTAG ATTTTTCTTC TGGGGATAAT GGGGTTCTTC ....|....| ....|....| ....|....| ....|....| ....|....| 360 370 380 390 400 KPS1 TGTTGTTGGA TTGATTTTGT TCTGAGGTAG AGTTTTCTAA GAAGAGAATG MN93 TGTTGTTGGA TTGATTTTGT TCTGAGGTAG AGTTTTCTAA GAAGAGAATG 263 TGTTGTTGGA TTGATTTTGT TCTGAGGTAG AGTTTTCTAA GAAGAGAATG KP11 TGTTGTTGGA TTGATTTTGT TCTGAGGTAG AGTTTTCTAA GAAGAGAATG ....|....| ....|....| ....|....| ....|....| ....|....| 410 420 430 440 450 KPS1 TTAAAGATAA TTTTGTGAAT ATACTGTGTT ATTAGCTTAA ATTTATTGTA MN93 TTAAAGATAA TTTTGTGAAT ATACTGTGTT ATTAGCTTAA ATTTATTGTA 263 TTAAAGATAA TTTTGTGAAT ATACTGTGTT ATTAGCTTAA ATTTATTGTA KP11 TTAAAGATAA TTTTGTGAAT ATACTGTGTT ATTAGCTTAA ATTTATTGTA ....|....| ....|....| ....|....| ....|....| ....|....| 460 470 480 490 500 KPS1 AATTGCTAAA TTTTCTAAGT TTTGTTTCTT ATATATAGTA TCAGACGTGA MN93 AATTGCTAAA TTTTCTAAGT TTTGTTTCTT ATATATAGTA TCAGACATGA 263 AATTGCTAAA TTTTCTAAGT TTTGTTTCTT ATATATAGTA TCAGACATGA KP11 AATTGCTAAA TTTTCTAAGT TTTGTTTCTT ATATATAGTA TCAGACATGA Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 82 ....|....| ....|....| ....|....| ....|....| ....|....| 510 520 530 540 550 KPS1 TTTTAATAAC TTCCAAAATA GTTCAATCAT TAATGGAGAG TAACTTAGAA MN93 TTTTAATAAC TTCCAAAATA GTTCAATCAT TAATGGAGAG TAACTTAGAA 263 TTTTAATAAC TTCCAAAATA GTTCAATCAT TAATGGAGAG TAACTTAGAA KP11 TTTTAATAAC TTCCAAAATA GTTCAATCAT TAATGGAGAG TAACTTAGAA ....|....| ....|....| ....|....| ....|....| ....|....| 560 570 580 590 600 KPS1 GGAAAATATT TCAGAGTGTG TAGGCAGATC TATTTGGAAA AATAAGCCAA MN93 GGAAAATATT TCAGAGTGTG TAGGCAGATC TATTTGGAAA AATAAGCCAA 263 GGAAAATATT TCAGAGTGTG TAGGCAGATC TATTTGGAAA AATAAGCCAA KP11 GGAAAATATT CCAGAGTGTG TAGGCAGATC TATTTGGAAA AATAAGCCAA ....|....| ....|....| ....|....| ....|....| ....|....| 610 620 630 640 650 KPS1 TATTTGCCTA ACAAAGTATC TTCTACCGAA CATGCACTTT GCCTCAGTGT MN93 TATTTGCCTA ACAAAGTATC TTCTACCGAA CATGCACTTT GCCTCAGTGT 263 TATTTGCCTA ACAAAGTATC TTCTACCGAA CATGCACTTT GCCTCAGTGT KP11 TATTTGCCTA ACAAAGTATC TTCTACCGAA CATGCACTTT GCCTCAGTGT ....|....| ....|....| ....|....| ....|....| ....|....| 660 670 680 690 700 KPS1 GGTATGGTGC AAAGCGGGTG AGAGAGAGCA AAAAGTTATG ATGCAAATAT MN93 GGTATGGTGC AAAGCGGGTG AGAGAGAGCA AAAAGTTATG ATGCAAATAT 263 GGTATGGTGC AAAGCGGGTG AGAGAGAGCA AAAAGTTATG ATGCAAATAT KP11 GGTATGGTGC AAAGCGGGTG AGAGAGAGCA AAAAGTTATG ATGCAAATAT ....|....| ....|....| ....|....| ....|....| ....|....| 710 720 730 740 750 KPS1 TTGTCATTTG AAGCTTGTGG AAGCCCATAA TCCATTATCA GAAGCCAGAA MN93 TTGTCGTTTG AAGCTTGTGG AAGCCCATAA TCCATTATCA GAAGCCAGAA 263 TTGTCATTTG AAGCTTGTGG AAGCCCATAA TCCATTATCA GAAGCCAGAA KP11 TTGTCATTTG AAGCTTGTGG AAGCCCATAA TCCATTATCA GAAGCCAGAA ....|....| ....|....| ....|....| ....|....| ....|....| 760 770 780 790 800 KPS1 TTGATTATTG ATTGTTAGGA TAAATTCTGC ATTTATCGTA TGTCAATGAA MN93 TTGATTATTG ATTGTTAGGA TAAATTCTGC ATTTATCGTA TGTCAATGAA 263 TTGATTATTG ATTGTTAGGA TAAATTCTGC ATTTATCGTA TGTCAATGAA KP11 TTGATTATTG ATTGTTAGGA TAAATTCTGC ATTTATCGTA TGTCAATGAA ....|....| ....|....| ....|....| ....|....| ....|....| 810 820 830 840 850 KPS1 TAAATGGTTT TGTGGCGTGA ATTTTAACAA CAAAGTTTGT CGTTTTTTTC MN93 TAAATGGTTT TGTGGCGTGA ATTTTAACAA CAAAGTTTGT CGTTTTTTTC 263 TAAATGGTTT TGTGGCGTGA ATTTTAACAA CAAAGTTTGT CGTTTTTTTC KP11 TAAATGGTTT TGTGGCGTGA ATTTTAACAA CAAAGTTTGT CGTTTTTTTC ....|....| ....|....| ....|....| ....|....| ....|....| 860 870 880 890 900 KPS1 TTTGTAGTAA TAGAAATGCT AACTGGTGTC TATTTTTATT TTGTTTTTAT MN93 TTTGTAGTAA TAGAAATGCA AACTGGTGTC TATTTTTATT TTGTTTTTAT 263 TTTGTAGTAA TAGAAATGCA AACTGGTGTC TATTTTTATT TTGTTTTTAT KP11 TTTGTAGTAA TAGAAATGCA AACTGGTGTC TATTTTTATT TTGTTTTTAT ....|....| ....|....| ....|....| ....|....| ....|....| 910 920 930 940 950 KPS1 TGATTGGTGA TGGCTATATA CAGAACGCCC TTCTGGAGTT TGGAAGGGTG MN93 TGATTGGTGA TGGCTATATA CAGAACGCCC TTCTGGAGTT TGGAAGGGTG 263 TGATTGTTGA TGGCTATATA CAGAACGCCC TTCTGGAGTT TGGAAGGGTG KP11 TGATTGGTGA TGGCTATATA CAGAACGCCC TTCTGGAGTT TGGAAGGGTG ....|....| ....|....| ....|....| ....|....| ....|....| 960 970 980 990 1000 KPS1 GTAAGTGCAC AACAGCAAGT GGTTTCTGGT ACCTTGTACA CCATCACTTT MN93 GTAAGTGCAC AACAGCAAGT GGTTTCTGGT ACCTTGTACA CCATCACTTT 263 GTAAGTGCAC AACAGCAAGT GGTTTCTGGT ACCTTGTACA CCATCACTTT KP11 GTAAGTGCAC AACAGCAAGT GGTTTCTGGT ACCTTGTACA CCATCACTTT Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 83 ....|....| ....|....| ....|....| ....|....| ....|....| 1010 1020 1030 1040 1050 KPS1 GGAGGCAAAA GATGGTGGGC AAAAGAAGGT TTATGAAGCC AAAGTCTGGG MN93 GGAGGCAAAA GATGGTGGGC AAAAGAAGGT TTATGAAGCC AAAGTCTGGG 263 GGAGGCAAAA GATGGTGGGC AAAAGAAGGT TTATGAAGCC AAAGTCTGGG KP11 GGAGGCAAAA GATGGTGGGC AAAAGAAGGT TTATGAAGCC AAAGTCTGGG ....|....| ....|....| ....|....| ....|....| ....|....| 1060 1070 1080 1090 1100 KPS1 AGAAGCCATG GTTGAACTTC AAGGAGCTGC AAGAGTTCAA ACTTGTTGGA MN93 AGAAGCCATG GTTGAACTTC AAGGAGCTGC AAGAGTTCAA ACTTGTTGGA 263 AGAAGCCATG GTTGAACTTC AAGGAGCTGC AAGAGTTCAA ACTTGTTGGA KP11 AGAAGCCATG GTTGAACTTC AAGGAGCTGC AAGAGTTCAA ACTTGTTGGA ....|....| ....| 1110 KPS1 GAGGCACCTG CATAG MN93 GAGGCACCTG CATAG 263 GAGGCACCTG CATAG KP11 GAGGCACCTG CATAG Fig 2. Nucleotide sequences of cystatin gene in four mungbean cultivars. The nulceotide sequence composes of two exon region (exon 1: 1-75 and exon 2: 923 – 1115, green colored) Table 1. Information of cystatin gene in four mungbean cultivars Cultivars Length (bp) Exon Intron Amino acid Code in EMBL 1 KP11 1115 2 1 88 AM712474 2 KPS1 1115 2 1 88 AM712475 3 MN93 1115 2 1 88 AM712476 4 263 1115 2 1 88 AM707027 Comparing the nucleotide sequence of the segment encoding of amino acid of cystatin gene of four mungbean cultivars with 9 nucleotide sequence of other crops in GenBank, of which have three cultivars of legumes, results be displayed at the Table 2. Table 2 shows that, compared with four mungbean varieties Arachis hypogaea have similar levels about nucleotide sequences of segment encoding is the highest (77.5%) and Malus domestica has the lowest similarity (30%). Nucleotide sequences of encoding segment of the four mungbean varieties and Vigna radiata variety in GenBank identical (100%). From results of the comparison similar level of the encoding segment of cystatin gene, dendrogram has been settings (Fig 3). Figure 3 shows, four mungbean cultivars and mungbean cultivar (code number: AF454396) have focused in a group. Table 2. Comparison of similar levels of the encoding segment of amino acid of cystatin gene of four mungbean cultivars with 9 nucleotide sequence of other crops in GenBank Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 84 The mungbean varieties have a high similarity coefficient with Vigna unguiculata and Arachis hypogaea so these two legume plants stand close to the best green beans in the tree graph, but Malus domestica and Daucus carota has the longest distance. difference of Malus domestica and Daucus carota compared to other crops is 55.2% coefficient of genetic similarity of cystatin genes of many different plants is hight have proved highly conservative of this gene. Comparison of deduced amino acid sequences of cloned cystatin gene Totally, the two coding regions of four cloned cystatin genes compose only of 267 nucleotides, that encoding a protein sequence of 88 amino acid residures. There is no single variation in amino acid sequence could de found between the four cultivars. The comparision with data submitted by Kang (2001) revealed even no difference between our four clones to that registed under AF454396 of NCBI (Fig 4). We also conducted to compare the similarities in amino acid sequences of four mungbean varieties with nine other crops (Table 3). Results showed, Arachis hypogaea has the same amino acid sequences with mungbean (69,3%), difference about the amino acid many sequence is most for Malus domestica (33%). Output showed, Arachis hypogaea and Vigna unguiculata have closer relations than Vigna radiata, Arachis hypogaea and Vigna unguiculata beans group, has close ties with Vigna radiata, so amino acids in proteins of the cystatin gene more conservative. Fig 3. Diagram tree to compare the degree of similarity of the gene encoding cystatin of some mungbean cultivars and other crops ....|....| ....|....| ....|....| ....|....| ....|....| 10 20 30 40 50 263 MSQELESVEI DSLARFAVEE HNKKQNALLE FGRVVSAQQQ VVSGTLYTIT KP11 MSQELESVEI DSLARFAVEE HNKKQNALLE FGRVVSAQQQ VVSGTLYTIT KPS1 MSQELESVEI DSLARFAVEE HNKKQNALLE FGRVVSAQQQ VVSGTLYTIT MN93 MSQELESVEI DSLARFAVEE HNKKQNALLE FGRVVSAQQQ VVSGTLYTIT AF454396 MSQELESVEI DSLARFAVEE HNKKQNALLE FGRVVSAQQQ VVSGTLYTIT ....|....| ....|....| ....|....| ....|... 60 70 80 263 LEAKDGGQKK VYEAKVWEKP WLNFKELQEF KLVGEAPA KP11 LEAKDGGQKK VYEAKVWEKP WLNFKELQEF KLVGEAPA KPS1 LEAKDGGQKK VYEAKVWEKP WLNFKELQEF KLVGEAPA MN93 LEAKDGGQKK VYEAKVWEKP WLNFKELQEF KLVGEAPA AF454396 LEAKDGGQKK VYEAKVWEKP WLNFKELQEF KLVGEAPA Fig 4. Comparison of the amino acids sequences of cystatin genes from KP11, KPS1, MN93, 263 with cystatin genes AF454396 (Vigna radiata L.). Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 85 Table 3. Comparison of homologous on amino acid in protein encoded by the cystatin gene of some mungbean and other crops CONCLUSIONS We were isolated cystatin genes from mungbean cultivars (Vigna radiata L. Wilczek) which PCR analysis using one primer pair (CysF, CysR). PCR products containing the cystatin fragment was cloned in pTZ57R/T and sepuenced. The cloned cystatin gene of four mungbean cultivars (KP11, KPS1, MN93 và 263) had 1115 nucleotides in length, including 2 exons (1- 75 and 923-1115) and 1 intron. The coding region of cystatin genes comprises of 267 nucleotides which encode a polypeptide of 88 amino acid residues. Nucleotide sequence of cystatin gene in the four mungbean cultivars (KP11, KPS1, MN93 and 263) have a high level of similarity (99.6% - 99.8%), without a change in the 2 exons, but there are 6 the single nucleotide polymorphism located in the introns. Comparision of the amino acid sequences of genes encoding cystatin in mungbean cultivars (KP11, KPS1, MN93, 263) with one mungbean cultivar on NCBI (AF454396), results shows that amino acid sequences was 100% homologous. The result obtained suggests that need further research on the role of control active of intron regions when the mungbean cultivars live In drought conditions. REFERENCES [1] Diop N.N., Kidric M., Repellin A., Gareil M., d'Arcy-Lameta A., Pham Thi A.T., Zuily-Fodil Y. (2004) A multicystatin is induced by drought-stress in cowpea (Vigna unguiculata (L.) Walp.) leaves, FEBS Lett. 577 (3): 545-50. [2] Filho J.X., (1992) The biological roles of serine and cysteine proteinase inhibitors in plants, R Bras. Fisiol. Veg. 4 (1): 1-6. [3] Gawel N.J., Jarret R.L. (1991) Genomic DNA isolation. % 20 lab % 20 manual. doc. [4] Kang,S.J., Kim,M.C., Yoo,D.W. and Park,K.S. Submitted (30-NOV-2001): Identification of cystatin in mungbean (Vigna radiata). http: //www.ncbi.nlm.nih.gov : AF454396 [5] Misaka T., Kuroda M., Iwabuchi K., Abe K., Arai S. (1996) Soyacystatin, a Novel Cysteine Proteinase Inhibitor in Soybean, is Distinct in Protein Structure and Gene Organization from Other Cystatins of Animal and Plant Origin, European Journal of Biochemistry. 240 (3): 609. [6] Oliveira A.S., Xavier-Filho J., Sales M.P. (2003), Cysteine proteinase and cystatins, Brazilian Archives of Biology and Technology, 46 (1): 91-104. [7] Ojima A., Shiota H., Higashi K., Kamada H., Shimma Y., Wada M., Satoh S., (1997), An extracellular insoluble inhibitor of cysteine proteinases in cell cultures and seeds of carrot, Plant Molecular Biology, 34 (1): 99-109. [8] Ryan S.N., McManus M.T., Laing W.A (2003), Identification and Characterisation of Proteinase Inhibitors and Their Genes from Seeds of Apple (Malus domestica). Biochem. 134 (1): 31-42. [9] Turk V, Bode W. (1991), The cystatins: protein inhibitors of cysteine proteinases, FEBS Lett. 285 (2): 213- 219. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên Nguyễn Vũ Thanh Thanh và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 78(02): 79 - 86 86 TÓM TẮT ĐẶC ĐIỂM CỦA GEN CYSTATIN Ở MỘT SỐ GIỐNG ĐẬU XANH VIỆT NAM [Vigna radiata (L.) Wilczek] Nguyễn Vũ Thanh Thanh1*, Chu Hoàng Mậu2 1 Bộ môn Di truyền học, Khoa Khoa học Sự sống, Trường Đại học Khoa học, TNU 2 Bộ môn Di truyền học&Sinh học hiện đại, Khoa Sinh –KTNN, Trường Đại học Sư phạm, TNU Cystatin là chất ức chế cystein proteinase thuộc họ papain. Ở thực vật, cystatins đƣợc tìm thấy khi cây bị stres hạn. Bài báo này kết quả của chnghiên cứu của chúng tôi về gen mã hóa cystatin phân lập từ các giống đậu xanh Việt Nam [Vigna radiata (L.) Wilczek] có mức độ chịu hạn khác nhau. DNA hệ gen của bốn giống đậu xanh, bao gồm hai với khả năng chịu hạn cao (KP11 và KPS1) và hai giống chịu hạn kém (MN93, 263) đƣợc tách chiết để nhân bản gen cystatin với cặp mồi đặc hiệu. Trình tự gen cystatin đƣợc nhân bản có kích thƣớc là 1115 nucleotide, có 2 exon và 1intron. Vùng mã hóa của gen cystatin bao gồm 267 nucleotide, mã hóa chuỗi polypeptide có 88 axit amin. Trình tự nucleotide của gen cystatin của bốn giống đậu xanh thể hiện sự khác nhau mặc dù trình tự acid amin không khác biệt nhau và khống khác với trình tự có mã số AF454396 ở GenBank. Sự khác biệt về chức năng có thể có quan hệ với những thay đổi đƣợc tìm thấy trong vùng intron. Trình tự nucleotide của gen cystatin của bốn giống đậu xanh (KP11, KPS1, MN93 và 263) có mức độ tƣơng đồng cao (99,6% - 99,8%), nhƣng không có một khác nhau nào trong 2 exon, nhƣng có 6 đa hình nucleotide đơn nằm trong vùng intron. So sánh trình tự axit amin của cystatin ở giống đậu xanh (KP11, KPS1, MN93, 263) với trình tự của giống đậu xanh trên Ngân hàng gen NCBI (mã số: AF454396) cho thấy trình tự axit amin có độ tƣơng đồng là 100%. Kết quả thu đƣợc cho thấy rằng cần nghiên cứu thêm về vai trò kiểm soát hoạt động của các vùng intron khi các giống đậu xanh sống trong điều kiện hạn hán. Keywords: Chất ức chế, đậu xanh, gen cystatin, stress hạn,Vigra radiata. * Tel: 0913.383.289; Email: [email protected] Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên

Các file đính kèm theo tài liệu này:

  • pdfbrief_33451_37272_79201210273378_split_6_1702_2052257.pdf