Xác định tần suất đột biến 185DELAG, 5382INSC trên gen Brca1 trong 10 gia đình ung thư vú tại tỉnh Hải Dương - Lê Thị Phượng

SUMMARY The study was carried out to determine the 185delAG and 5382insC mutations of BRCA1 gene in 10 families with history of breast cancer with 40 women including 25 breast cancer patients and 15 women who haven’t been detected to have breast cancer. The result showed that frequency of the mutations 185delAG and 5382insC were 0/40 (0.0%) and 3/40 (7.5%) respectively. We detected two sisters in a family with breast cancer carried 5382insC. Hence, the mutations 185delAG and 5382insC of BRCA1 gene were not common among women in family history of breast cancer in Hai Duong province.

doc7 trang | Chia sẻ: thucuc2301 | Lượt xem: 435 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Xác định tần suất đột biến 185DELAG, 5382INSC trên gen Brca1 trong 10 gia đình ung thư vú tại tỉnh Hải Dương - Lê Thị Phượng, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
TAP CHI SINH HOC 2015, 37(1se): 158-164 DOI: 10.15625/0866-7160/v37n1se. XÁC ĐỊNH TẦN SUẤT ĐỘT BIẾN 185DELAG, 5382INSC TRÊN GEN BRCA1 TRONG 10 GIA ĐÌNH UNG THƯ VÚ TẠI TỈNH HẢI DƯƠNG Lê Thị Phượng Trường Đại học Kỹ thuật Y tế Hải Dương, phuongsinh@ymail.com TÓM TẮT: Nghiên cứu này nhằm xác định tần xuất đột biến 185delAG, 5382insC trên gen BRCA1 (breast cancer 1) ở phụ nữ ung thư vú (UTV) và người chưa mắc bệnh thuộc nhóm nguy cơ cao trong 10 gia đình có tiền sử UTV với 40 phụ nữ gồm: 25 bệnh nhân UTV và 15 người chưa mắc bệnh. Kết quả cho thấy, tần suất đột biến 185delAG và 5382insC trên gen BRCA1 lần lượt là 0/40 (chiếm 0,0%) và 3/40 (chiếm 7,5%). Đột biến 5382insC xuất hiện ở bệnh nhân ung thư vú trong gia đình có 2 chị em gái cùng mắc UTV. Như vậy, đột biến 185delAG, 5382insC không phải là đột biến phổ biến ở nhóm phụ nữ thuộc các gia đình có tiền sử ung thư vú tại tỉnh Hải Dương. Từ khóa: Đột biến gen BRCA1, nhóm nguy cơ cao, 185delAG, 5382insC, ung thư vú. MỞ ĐẦU Ung thư vú là một bệnh ung thư hay gặp nhất ở phụ nữ, là nguyên nhân chính gây tử vong đối với phụ nữ tại nhiều nước trên thế giới. Tỷ lệ UTV ngày càng tăng ở các nước đang phát triển (khoảng 5%/năm) đặc biệt ở khu vực Đông Nam Á [6]. Ở Việt Nam, tần suất ung thư vú là 12,2/100.000 dân tại TPHCM và 26,7/100.000 dân tại Hà Nội [6]. Mỗi năm có thêm khoảng 14.000 phụ nữ bị mắc mới ở độ tuổi 40-60, tuy nhiên, những năm gần đây bệnh xuất hiện cả ở phụ nữ còn trẻ trong độ tuổi 20-30 với tần số tăng dần [8]. Nhiều nghiên cứu ở Hoa Kỳ và châu Âu cho rằng khoảng 10-15% ung thư vú có yếu tố gia đình, nghĩa là người bệnh mang gen đột biến di truyền từ cha mẹ. Những năm gần đây, nhờ sự phát triển mạnh của sinh học phân tử, nhiều nhà khoa học đã tiến hành nghiên cứu và phát hiện nhiều đột biến điểm trên gen BRCA1 [3,12]. Những đột biến nguyên khởi trên gen BRCA1 liên quan đến UTV được nghiên cứu ở các tộc người khác nhau và có liên quan mật thiết với UTV là đột biến 185delAG, 5382insC. Một số nghiên cứu gần đây cũng chứng minh rằng tần suất đột biến 185delAG, 5382insC trên gen BRCA1 là khá cao ở những phụ nữ có tiền sử ung thư vú gia đình [1,15,5]. Việc phát hiện người bệnh mang đột biến nguyên khởi trong các gia đình bệnh nhân UTV rất có ý nghĩa trong việc tiên lượng và điều trị dự phòng. Mặt khác, việc phát hiện người lành mang gen đột biến cũng giúp các nhà tư vấn di truyền đưa ra lời khuyên hoặc lời cảnh báo về một nguy cơ UTV cho những thành viên trong gia đình họ. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Có 40 phụ nữ trong 10 gia đình UTV tại Bệnh viện Đa khoa tỉnh Hải Dương thỏa mãn điều kiện: i) bản thân bị ung thư vú và có ít nhất một người quan hệ bậc I (mẹ, con gái, chị em gái ruột) bị ung thư vú; ii) bản thân bị ung thư vú và có ít nhất một người quan hệ bậc II (bà nội/ngoại ruột, cô/dì ruột, cháu gái ruột) bị ung thư vú hai bên hoặc ung thư vú kèm ung thư buồng trứng. Quy trình tách chiết DNA:  0,5 ml máu toàn phần với 0,5 ml lysis buffer. Ly tâm thu cặn, lặp lại 4 lần. Thêm 0,5 ml protease K, ly tâm thu cặn. Thêm 0,5 ml lysis buffer; 12,5µl SDS 10%; 10µl protease K; ủ ở 56oC từ 2-3 giờ. Thêm 0,5 ml Phenol: Chlorofom: Isoamyl (tỷ lệ 25:24:1), ly tâm thu dịch chứa DNA. Thêm 400 µl Chlorofom: Isoamyl (tỷ lệ 24:1), ly tâm thu dịch trong. Tủa DNA bằng cồn tuyệt đối, để ở -20oC qua đêm. Ly tâm thu tủa DNA. Bảo quản ở - 20oC cho tới khi thực hiện phản ứng PCR. Trình tự mồi cho phản ứng PCR: Mồi P1, P2, P3 dùng để khuếch đại đoạn DNA-185delAG có trình tự 5’-3’ là: F(P1) ggttggcagcaatatgtgaa; R(P2) gctgacttaccagatggg actctc; MR(P3) cccaaattaatacactcttgtgctgacttacc agatgggacagta. Mồi P4, P5, P6 dùng để khuếch đại đoạn DNA-5382insC có trình tự 5’-3’ là: R(P4)gacgggaatccaaattacacag; F (P5) aaagcgagc aagagaatcgca; MF(P6) aatggaagaaaccaccaaagtcc ttagcgagcaagagaatcacc [10,12]. Thành phần và điều kiện PCR: 10 µl phản ứng PCR đa mồi (P1, P2, P3 đều có nồng độ 10pM) khuếch đại đoạn DNA-185delAG có thành phần gồm 1,0 µl Buffer10x; 0,25 µl dNTP 10 mM; 0,5 µl mỗi loại mồi P1 và P3 ; 0,25 µl P2 ; 0,3 U Taq polymerase; 1,0 µl DNA khuôn; 6,2 µl H2O. Chu trình nhiệt của phản ứng: 95oC-5 phút; 35 chu kỳ (95oC-20 giây; 58oC-30 giây; 72oC -30 giây); 72oC-5 phút. Mười µl phản ứng PCR đa mồi (P4, P5, P6 đều có nồng độ 10pM) khuếch đại đoạn DNA-5382insC có thành phần phản ứnggồm 1,0 µl Buffer10x; 0,25 µl dNTP 10 mM; 0,5 µl mỗi loại mồi P4, P5 và P6 (10pM); 0,2 U Taqpolymerase; 1,0 µl DNA khuôn; 6,05 µl H2O. Chu trình nhiệt của phản ứng như sau: 95oC-5 phút; 35 chu kỳ (94oC-15 giây; 57oC-15giây; 72oC-30 giây); 72oC-5 phút. Xác định trình tự đoạn DNA-185delAG và DNA-5382insC: Sản phẩm PCR được gắn vào vector tách dòng pJET1.2 đầu bằng. DNA tái tổ hợp được biến nạp vào tế bào khả biến E. coli để chọn lọc và tạo dòng. Plasmid tái tổ hợp được xác định trình tự nucleotide trên máy 3100-Avant Genetic Analyzer (ABI-PRISM) với bộ kit BigDye terminator v2.0. Các thông số trình tự nucleotide và chất lượng đỉnh được thu thập và kiểm định bằng các phần mềm ABI Data Collection và ABI SeqScape. Mỗi đoạn DNA-185delAG và DNA-5382insC được đọc trình tự 2 chiều, đối chiếu với trình tự nucleotide trên Genbank mang accession number NG_005905. KẾT QUẢ VÀ THẢO LUẬN Kết quả phản ứng PCR đa mồi nhân đoạn DNA-185delAG (hình 1) CA 1 2 3 4 5 ĐC M 300 bp 335 bp Hình 1. Kết quả điện di đồ xác định đột biến 185delAG CA: Mẫu chứng âm không có DNA khuôn; 1-5: Mẫu xét nghiệm; M: Thang DNA chuẩn 100 bp; ĐC: Mẫu đối chứng (người lành không mang đột biến). Theo Pak Cheung (1999) [12], khi sử dụng đồng thời cả 3 mồi P1, P2, P3 trong cùng một phản ứng PCR sẽ xảy ra một trong các trường hợp sau: Trường hợp 1: Trên bản gel điện di xuất hiện 2 băng DNA với kích thước ước đoán 335 bp (cho alen bình thường) và 354 bp (cho alen đột biến). Chứng tỏ mẫu mang đột biến 185delAG và ở trạng thái dị hợp. Trường hợp 2: Trên bản gel điện di xuấthiện một băng với kích thước ước đoán 335 bp. Chứng tỏ mẫu không mang đột biến 185delAG. Trường hợp 3: Trên bản gel điện di chỉ xuất hiện một băng với kích thước ước đoán 354 bp. Chứng tỏ mẫu mang đột biến 185delAG ở trạng thái đồng hợp tử [12]. Pavin (2006) [14] đã phân tích đột biến 185 delAG của 400 bệnh nhân ung thư vú thời kỳ đầu người Iran bằng phương pháp PCR đa mồi và cũng đưa ra kết luận tương tự như Pak Cheung. Kết quả ở hình 1 cho thấy, ngoại trừ mẫu chứng âm không xuất hiện băng DNA, các mẫu xét nghiệm từ 1-5 chỉ xuất hiện một băng DNA, băng này trùng với vị trí băng của mẫu đối chứng (người lành không mang đột biến 185delAG) và có kích thước ước đoán 335 bp. Chứng tỏ các mẫu bệnh nhân từ giếng 1-5 không mang đột biến 185delAG. Để khẳng định chắc chắn hơn, chúng tôi chọn ngẫu nhiên một số mẫu, tiến hành nhân dòng đoạn gen 335 bp. Sản phẩm PCR được đưa vào vector tách dòng pJET1.2 đầu bằng. DNA tái tổ hợp được biến nạp vào tế bào khả biến E. coli để chọn lọc và tạo dòng. Plasmid tái tổ hợp được xử lý với enzyme XhoI và XbaI để sàng lọc những plasmid mang đoạn gen cần tách dòng. Plasmid mang đoạn DNA-185delAG được tiến hành đọc trình tự bằng cặp mồi pJET 1.2 và so sánh với trình tự BRCA1 trên Genbank mã số 005905. Kết quả thể hiện ở hình 2. 93620 93630 93640 93650 93660 93670 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t ggagaaagga aaagacccaa ggggttggca gcaatatgtg aaaaaattca gaatttatg 185delAG - ---------- ---------- --GGTTGGCA GCAATATGTG AAAAAATTCA GAATTTATG 93680 93690 93700 93710 93720 93730 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t tgtctaatta caaaaagcaa cttctagaat ctttaaaaat aaaggacgtt gtcattagt 185delAG T TGTCTAATTA CAAAAAGCAA CTTCTAGAAT CTTTAAAAAT AAAGGACGTT GTCATTAGT 93740 93750 93760 93770 93780 93790 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t ctttggtttg tattattcta aaaccttcca aatcttaaat ttactttatt ttaaaatga 185delAG T CTTTGGTTTG TATTATTCTA AAACCTTCCA AATCTTAAAT TTACTTTATT TTAAAATGA 93800 93810 93820 93830 93840 93850 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t aaaatgaagt tgtcatttta taaacctttt aaaaagatat atatatatgt ttttctaat 185delAG T AAAATGAAGT TGTCATTTTA TAAACCTTTT AAAAAGATAT ATATATATGT TTTTCTAAT 93860 93870 93880 93890 93900 93910 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 g tgttaaagtt cattggaaca gaaagaaatg gatttatctg ctcttcgcgt tgaagaagt 185delAG G TGTTAAAGTT CATTGGAACA GAAAGAAATG GATTTATCTG CTCTTCGCGT TGAAGAAGT 93920 93930 93940 93950 93960 93970 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 a caaaatgtca ttaatgctat gcagaaaatc ttagagtgtc ccatctggta agtcagcac 185delAG A CAAAATGTCA TTAATGCTAT GCAGAAAATC TTAGAGAGTC CCATCTGGTA AGTCAG--- Hình 2. Kết quả đọc trình tự đoạn DNA-185delAG ở bệnh nhân 1.II.2 Kết quả ở hình 2 cho thấy, kích thước đoạn DNA-185delAG của mẫu xét nghiệm là 335 bp, phù hợp với tính toán lý thuyết và không có đột biến 185delAG ở mẫu bệnh nhân số 1.II.2. Điều này cho thấy phương pháp xác định đột biến 185delAG bằng PCR đa mồi có độ tin cậy cao. Như vậy, đột biến 185delAG không xuất hiện ở cả 40 mẫu xét nghiệm. Kết quả này phù hợp với Lê Thị Minh Chính (2004) [2] và Sng (2000) [16]. Tuy nhiên, chúng tôi phát hiện ở vị trí 93957 xuất hiện sự thay đổi nucleotide T bằng nucleotide A. Điều này gợi ý cho thấy có thể xuất hiện các đột biến khác đặc trưng cho phụ nữ Việt Nam trên gen BRCA1. Kết quả xác định đột biến 5382insC trên gen BRCA1 (hình 3) Theo Pak (1999) [12], khi sử dụng đồng thời cả 3 mồi P4, P5, P6 trong cùng phản ứng PCR sẽ xảy ra một trong các trường hợp sau: Trường hợp 1: Trên bản gel điện di, xuất hiện 2 băng DNA ở hai vị trí khác nhau, một băng trùng với vị trí băng của mẫu chứng dương (294 bp) tương ứng với alen đột biến, còn một băng (271 bp) thấp hơn băng của mẫu chứng dương, tương ứng với alen bình thường. Chứng tỏ bệnh nhân mang đột biến 5382insC và ở trạng thái dị hợp. 1 2 3 4 CD M 1 2 3 4 5 CD M 294 bp 271 bp 294 bp Hình 3. Kết quả điện di đồ xác định đột biến 5382insC M: Thang DNA chuẩn 100 bp; các giếng 1 - 4, 5 - 9: Mẫu bệnh nhân; CD: Mẫu chứng dương (mẫu mang đột biến5382insC) Trường hợp 2: Trên bản gel điện di xuất hiện 1 băng ở vị trí thấp hơn băng của mẫu chứng dương, với kích thước ước đoán 271 bp. Chứng tỏ không có đột biến 5382insC. Trường hợp 3: Trên bản gel điện di chỉ xuất hiện 1 băng DNA trùng với vị trí băng của mẫu chứng dương, với kích thước ước đoán 294 bp. Chứng tỏ bệnh nhân này mang đột biến 5382insC ở trạng thái đồng hợp tử [10]. Pavin et al. (2006) [‎13] cũng sử dụng phương pháp PCR đa mồi phát hiện đột biến 5382insC và cũng có những kết luận tương tự như Pak [12]. Hình 3 thể hiện kết quả đột biến 5382insC. Ở giếng 1, 3, 8 trên bản gel điện di xuất hiện 2 băng, trong đó có một băng có kích thước 294bp trùng với vị trí băng của mẫu chứng dương, còn một băng có kích thước 271bp thấp hơn vị trí băng của mẫu chứng dương. Kích thước này phù hợp với tính toán lý thuyết, chứng tỏ mẫu xét nghiệm ở giếng 1, 3, 8 mang đột biến 5382 insC ở dạng dị hợp tử. Các mẫu ở giếng 2, 4, 5, 6, 7, 9 chỉ xuất hiện một băng có kích thước ước đoán 271 bp thấp hơn băng của mẫu chứng dương, chứng tỏ các mẫu xét nghiệm này không mang đột biến 5382 insC. Để khẳng định chắc chắn hơn, chúng tôi tiến hành nhân dòng đoạn DNA-5382 insC, tách DNA plasmide đọc trình tự. Sử dụng enzyme cắt XhoI và XbaI để sàng lọc những plasmid mang đoạn 5382 insC. Sản phẩm cắt gồm 2 băng có kích thước lần lượt khoảng 2949 bp và khoảng 320 bp. Kết quả thể hiện ở hình 4. 1 2 3 M 320 bp 300 bp 2949 bp Hình 4. Sản phẩm cắt plasmid mang đoạn 5382insC với enzyme XhoI và XbaI. M: Thang DNA chuẩn 1 kb; 1-3: Sản phẩm cắt plasmid. Kết quả đọc trình tự đoạn DNA-5382 insC 160860 160870 160880 160890 160900 160910 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 a gtcagaggag atgtggtcaa tggaagaaac caccaaggtc caaagcgagc aagagaatc 5382insC - ---------- --------AA TGGAAGAAAC CACCAAGGTC CTTAGCGAGC AAGAGAATC 160920 160930 160940 160950 160960 160970 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 c ccaggacaga aaggtaaagc tccctccctc aagttgacaa aaatctcacc ccaccactc 5382insC G CCAGGACAGA AAGGTAAAGC TCCCTCCCTC AAGTTGACAA AAATCTCACC CCACCACTC 160980 160990 161000 161010 161020 161030 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t gtattccact cccctttgca gagatgggcc gcttcatttt gtaagactta ttacataca 5382insC T GTATTCCACT CCCCTTTGCA GAGATGGGCC GCTTCATTTT GTAAGACTTA TTACATACA 161040 161050 161060 161070 161080 161090 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 t acacagtgct agatactttc acacaggttc ttttttcact cttccatccc aaccacata 5382insC T ACACAGTGCT AGATACTTTC ACACAGGTTC TTTTTTCACT CTTCCATCCC AACCACATA 161100 161110 161120 161130 161140 161150 | ....|....| ....|....| ....|....| ....|....| ....|....| ....|.... NG_005905 a ataagtattg tctctacttt atgaatgata aaactaagag atttagagag gctgtgtaa 5382insC A ATAAGTATTG TCTCTACTTT ATGAATGATA AAACTAAGAG ATTTAGAGAG GCTGTGTAA 161160 161170 161180 161190 161200 | ....|....| ....|....| ....|....| ....|....| NG_005905 t ttggattccc gtctcgggtt cagatcttag ctgataagtg 5382insC T TTGGATTCCC GTC-------- ---------- ---------- Hình 5. Kết quả đọc trình tự đoạn DNA-5382insC Trình tự đoạn DNA-5382insC của 3 mẫu bệnh nhân mang mã số 2.II.1; 5.III.2; 9.II.1 được đối chiếu với trình tự nucleotide trên Genbank mã số 005905 (NCBI). Kết quả cho thấy cả 3 mẫu xét nghiệm đều mang đột biến 5382insC (hình 5). Như vậy, trong tổng số 40 phụ nữ ở 10 gia đình ung thư vú, có 3/40 bệnh nhân mang đột biến 5382insC chiếm 7,5%. Theo thống kê của Dewajani et al. (2007) [4], tỷ lệ bệnh nhân mang đột biến 5382insC dao động trong khoảng 0,13-23,4% ở tộc người Do Thái. Nhưng với dân số châu Á, tỷ lệ bệnh nhân mang đột biến 5382insC tương đối thấp. Philippin, Malaysia, Nhật Bản, Hàn Quốc, Thái Lan, tỷ lệ bệnh nhân mang đột biến 5382insC dao động trong khoảng 0-0,13%, còn ở dân số châu Âu, tỷ lệ bệnh nhân mang đột biến này xuất hiện cao nhất ở một số đại diện như Ba Lan - Upper Silesia 23,4% [7], Đông Âu 1,95% [11]. Kết quả nghiên cứu của chúng tôi (7,5%)thấp hơn nhiều so với nguời Ahskenazi, châu Âu nhưng lại cao hơn so với dân số các nước châu Á như Trung Quốc, Nhật Bản, Thái Lan, Singapo, Malaysia [3, 9, 10, 14]. Điều này có thể được giải thích là do yếu tố chủng tộc hoặc do các yếu tố ngoại sinh như điều kiện môi trường sống, tập quán ăn uống, hoặc do chiến tranh để lại chất độc hóa học. Đây mới chỉ là một đột biến điểm trên gen BRCA1, còn nếu tính chung trên cả gen thì không loại trừ khả năng bệnh nhân UTV có đột biến điểm hoặc các đột biến khác trên gen BRCA1 chiếm tỷ lệ cao hơn nhiều so với các nước khác. KẾT LUẬN Đột biến 5382insC chiếm tỷ lệ khá cao ở nhóm phụ nữ ung thư vú và nhóm người có nguy cơ cao mắc ung thư vú. Ngược lại, đột biến 185delAG không phải là đột biến phổ biến trong các gia đình có tiền sử ung thư vú tại tỉnh Hải Dương. TÀI LIỆU THAM KHẢO Anca Negură, Lucian Negură, 2012. BRCA1 185delAG mutation can be easily detected by an adapted allele - specific PCR. Secţiunea Genetică şi Biologie Moleculară, TOM XIII, 2012. Lê Thị Minh Chính, Đái Duy Ban, Hoàng Minh Châu, 2004. Kết quả nghiên cứu đột biến gen BRCA1 và BRCA2 ở 24 bệnh nhân ung thư vú Việt Nam. Những vấn đề nghiên cứu cơ bản trong khoa học sự sống. De Leon Matsuda M. L., Liede A., Kwan E., Mapua C. A., Cutiongco E. M., Tan A., Borg A., Narod S. A., 2002. BRCA1 and BRCA2 mutations among breast cancer patients from the Philippines. Intl J. Cancer, 98: 596-603. Dewajani P., Gerard P., Artanto W., Teguh A., Tjakra W. M., Samuel J. H., Paul J. D., 2007. BRCA1 and BRCA2 germline mutation analysis in the Indonesian population. Breast Cancer Res Treat 106:297–304. Dillenburg C. V., Bandeira I. C., Tubino T. V., Rossato L. G., Dias E. S., Bittelbrunn A. C., Leistner-Segal S., 2012. Prevalence of 185delAG and 5382insC mutations in BRCA1,and 6174delT in BRCA2in women of Ashkenazi Jewish origin in southern Brazil. Genetics and Molecular Biology, 35(3): 599-602. Anh P.T., Duc N.B., 2002. The situation with cancer control in Vietnam. Jpn J Clin Oncol 32 Suppl:S92-7. Ewa G., Marzena S., Helena Z., Ewa K., Jadwiga M., Beata U. H., Jadwiga R. S. and Maria K. M., 2002. Germline mutations in the BRCA1 gene predisposing to breast and ovarian cancers in Upper Silesia population. Acta Biochimica Polonica.Vol.49:51–356. Ghaffari S. R., Sabokbar T., Tahmasebi S., Dastan J., Shorakae S., Moradi A., Tirgari F., Mohagheghi M. A., Mosavi-Jarrahi A., 2006. Combining mammaglobulin and carcinoembryonic mRNA Markers for early detection of micrometastases from breast cancers - a molecular study of 59 patients. Asian Pac J Cancer Prev, 7(3): 396-8. Ho G. H., Phang B. H., Ng I. S., Law H. Y., Soo K.C., Ng E. H., 2000. Novel germline BRCA1 mutations detected in women in Singapore who developed breast carcinoma before the age of 36 years. Cancer, 89: 811-816. Lovelock P. K., Spurdle A. B., Mok M. T., Farrugia D. J., Lakhani S. R., Healey S.,  Arnold S., Buchanan D., kConFab Investigators, Couch F. J., Henderson B. R., Goldgar D. E.,Tavtigian S. V., Chenevix-Trench G., Brown M. A., 2007. Identification of BRCA1 missense substitutions that confer partial functional activity: potential moderate risk variants? Breast Cancer Research, 9(6):R82. doi10.1186/bcr:1826. Mitrofanov D. V., Chasovnikova O. B., Kovalenko S. P. and Lyakhovich V. V., 2009. Detection of the 5382insC mutation in the Human BRCA1 gene using fluorescent labeled oligonucleotides. Molecular Biology. Vol. 43, No. 6, pp. 930-936. Pak C. R. C., Betty Y. L. W., Hilmi O., David E. C. C., 1999. Simple and Rapid Detection of BRCA1 and BRCA2 mutations by multiplex mutagenically separated PCR. Clinical Chemistry, 45(8): 1285-1287. Parvin M., Saied H. A., Arezoo S. E., Laleh H., Ehsan A., Morteza A., 2006. Low Frequency of 185delAG Founder Mutation of BRCA1 Gene in Iranian Breast Cancer Patients. Journal of Cancer Molecules, 2(3): 123-127. Patmasiriwat P., Bhothisuwan K., Sinilnikova O. M., Chopin S., Methakijvaroon S., Badzioch M., Padungsutt P., Vattanaviboon P., Vattanasapt V., Szabo C., Saunders G. F., Goldgar D., and Lenoir G. M., 2002. Analysis of breast cancer susceptibility genes BRCA1 and BRCA2 in Thai familial and isolated early-onset breast and ovarian cancer Hum. Mutation, 20(3): 230. Sadr-nabavi A., Dastpak M., Homaei-Shandiz F., Bahrami A. R., Bidkhori H. R., Raeesolmohaddeseen M., 2014. Analysis of novel mutations in BRCA1 in Iranian families with breast cancer hereditas 151: 38-42. Sng J. H., Chang J., Feroze F., Rahman N., Tan W., Lim S., Van D. P., Wong J.S., 2000. The prevalence of BRCA1 mutations in Chinese patients with early onset breast cancer and affected relatives. British Journal of Cancer, 82(3): 538-542. DETERMINATION OF 185delAG AND 5382insC MUTATIONS OF BRCA1 GENE IN 10 FAMILIES WITH BREAST CANCER IN HAI DUONG PROVINCE Le Thi Phuong Hai Duong Medical Technical University SUMMARY The study was carried out to determine the 185delAG and 5382insC mutations of BRCA1 gene in 10 families with history of breast cancer with 40 women including 25 breast cancer patients and 15 women who haven’t been detected to have breast cancer. The result showed that frequency of the mutations 185delAG and 5382insC were 0/40 (0.0%) and 3/40 (7.5%) respectively. We detected two sisters in a family with breast cancer carried 5382insC. Hence, the mutations 185delAG and 5382insC of BRCA1 gene were not common among women in family history of breast cancer in Hai Duong province. Keywords: Breast cancer, 5382insC, 185delAG, high risk groups, mutations of BRCA1 gene. Ngày nhận bài: 22-10-2014

Các file đính kèm theo tài liệu này:

  • doc6105_22163_1_pb_4152_2168_2017997.doc