Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
77
THE DROUGHT TOLERANT CHARACTERISTICS OF SOME UPLAND LOCAL
MAIZE CULTIVARS (ZEA MAYS L.) IN THE NORTH OF VIET NAM
Chu Hoang Mau
1*
, Nguyen Vu Thanh Thanh
2
, Pham Thi Thanh Nhan
1
1* Department of Genetics and Modern Biology, College of Education - TNU
2 Department of Genetics, College of Science - TNU
SUMMARY
Maize (Zea mays L.) is one of the widely grown grains in Viet Nam. The local upland maize
cultivars play an important role for the life of people living in mountainous regions in the North of
Viet Nam. The quality of seed and drought tolerance ability of local upland maize cultivars are
good. In this work, we have studied drought tolerance character and dehydrin gene of some local
upland maize cultivars. Among them these are six cultivars with high drought tolerance ability
(BK, HL, QH, YM, TL, and QU) and two maize cultivars BG and VN2 with low drought tolerance
ability. Dehydrin – LEA (lete embryogenesis abundant) – D11 is a plant protein family in a
number of higher plants, a species of protein produced by plants during drought or low
temperature stress. These are six dehydrin protein types of maize: dhn1, dhn2, dhn3, dhn4, dhn5,
and dhn6. DHNs are unified by the presence of one or more copies of a putative amphipathic α -
helix-forming domain (the K-segment), which is highly conserved in higher and lower plants and
has a 15 residue consensus sequence EKKGIMDKIKEKLPG. We had cloned dhn1 gene from
DNA of genome of local upland maize cultivars. The 0.6 kb of dhn1 gene was amplified by PCR
and carry out successfully with LeaZeM1 primers. Cloning of PCR products and DNA sequencing
is carrying out.
Keywords: Dehydrin, drought, upland local, maize,Dhn1, cloning, PCR
INTRODUCTION
Maize is widely cultivated throughout the
world. Maize (Zea mays L.) is also one of the
widely grown grains in Viet Nam. The local
upland maize cultivars play an important role
for the life of people living in mountainous
regions in the North of Viet Nam. The quality
of seeds, drought tolerance ability and
resistant ability for of local upland maize
cultivars are good. Therefore, the preservation
of the gene resource of the local upland maize
cultivars is now very necessary. To research
on drought tolerance ability of local upland
maize cultivars, we isolated dehydrin gene.
Dehydrin – LEA (late embryogenesis
abundant) – D11 and dehydrins are products
of multigene families in a number of higher
plants (Close, 1996) [2], a species of protein
produced by plants during drought or low
temperature stress. These are six dehydrin
protein types of maize: dhn1, dhn2, dhn3,
dhn4, dhn5, and dhn6. DHNs are unified by
Tel:0913 383 289; Email:
[email protected]
the presence of one or more copies of a
putative amphipathic α -helix-forming
domain (the K-segment), which is highly
conserved in higher and lower plants and has
a 15 residue consensus sequence
EKKGIMDKIKEKLPG (Allagulova et
al.,2003 [1]; Hong-Bo et al., 2005 [6]; Yuxiu
et al. 2007 [15]). Dehydrins (DHNs; late
embryogenesis abundant D-11) are a family
of plant proteins induced in response to
abiotic stresses such as drought, low
temperature, and salinity or during the late
stages of embryogenesis (Close, 1989 [3];
Allagulova et al., 2003 [1], Roat, 2006 [14]).
In Viet Nam, quality of seeds, drought
tolerance ability and resistant ability for of
local upland maize cultivars in the North
have are good (Mau and Anh, 2005 [10];
Nhan et al., 2007 [13]), they are diversity of
phenotype and genotype (Mau and Anh.,
2006 [11]). The genetic diversity and
diversity of dehydrin gene of Viet Nam maize
cultivars has been researched (Lien et al.,
2005 [8]; Mau et al, 2007 [12]).
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
78
MATERIALS AND METHODS
Eight local maize cultivars (BK, HL, QH,
YM, TL, QU, BG and VN2) provided by the
mountainous region of North in Viet Nam
(Table 1).
One specific primer pair, including:
LeaZeM1F 5' ATGGAGTACGGTCAGCAGGGGC 3‟
LeaZeM1R 5' TCAGTGCTGTCCGGGCAGC 3'
Cloning pTZ57R/T vectors. Both primers
and vector are supplied by Fermentas.
Definition of sugar content and α- amylase
activity value at the germinating stage by 5%
sorbitol treatment. Assessment of drought
tolerance ability of eight maize cultivars at
the plantlet stage by factitious drought
treatment. Definition of the dissimilar
coefficients of maize cultivars by the
NTSYSpc- 2.02i program.
Total DNA is separated from leaf of eight
maize cultivars following the method of
Gawel and Jarnet (Gawel et al., 1991) [4].
PCR is performed in a total volume of 50 μl.
PCR conditions are: an initial denaturation
step of 94
0
C for 3 min, followed by 30 cycles
of 94
0
C for 30 sec, 57
0
C for 1 min and 72
0
C
for 1 min. The final extension step is 72
0
C for
10 min. The PCR products are checked by 1%
agarose gel electrophoresis.
PCR products are cloned into pTZ57R/T
(Glick et al., 1998) [5].
RESULTS AND DISCUSSIONS
The drought tolerance ability of some local
Vietnamese maize cultivars
* The analysis of biochemistry characters at
the germinating stage:
We researched on sugar content and α-
amylase activity in 8 maize cultivars at the
germinating stage by 5% sorbitol treatment.
The results have shown in table 2 and table 3.
When treating physiological drought by 5%
sorbitol treatment, sugar content and α-
amylase activity were also increased from 1
to 11 day germ maize, and decreased at 14
day germ maize, highest at 11 day germ
maize. HL cultivar had the highest sugar
content and α- amylase activity, VN2 cultivar
was lowest.
Table 1. Origin of eight maize cultivars in the North of Vietnam
Order Maize cultivars Wax/flint Origin
1 BG Wax Local Bacgiang cultivar
2 BK Wax Local Backan cultivar
3 HL Wax Local Halang-Cao Bang cultivar
4 QH Wax Local Quanghoa- Caobang cultivar
5 YM Wax Local Yenminh- Ha Giang cultivar
6 TL Wax Local Tralinh- Cao Bang cultivar
7 VN2 Wax Hybrids Vietnam cultivar
8 QU Flint Local Quanguyen- Cao Bang cultivar
Table 2. The variation of sugar content of 8 maize cultivars by 5% sorbitol treatment
Maize
Cultivars
The variation of sugar content at the germinating stage by 5% sorbitol treatment (%)
1 day
germ
maize
3 day
germ
maizet
5 day
germ
maizet
7 day
germ
maize
9 day
germ
maize
11 day
germ
maize
14 day
germ
maize
BG 0.53± 0.08 0.65± 0.02 0.67± 0.06 1.04± 0.01 1.05± 0.01 1.32± 0.05 0.58± 0.01
BK 0.34± 0.03 0.40 ±0.08 0.79±0.01 1.04± 0.02 1.05± 0.01 1.33± 0.03 0.60± 0.01
HL 0.23± 0.03 0.52± 0.10 0.79± 0.01 1.05± 0.01 1.06± 0.01 1.39± 0.02 0.64± 0.03
QH 0.30± 0.05 0.59± 0.06 0.82± 0.03 1.05± 0.01 1.06± 0.00 1.34± 0.06 045± 0.09
YM 0.29± 0.02 0.57± 0.02 0.85± 0.03 1.05± 0.01 1.07± 0.00 1.32± 0.04 0.55± 0.09
TL 0.33± 0.03 0.60± 0.10 0.84± 0.11 1.05± 0.02 1.06± 0.00 1.35± 0.04 0.47± 0.07
VN2 0.18± 0.04 0.50± 0.03 0.68± 0.05 1.02± 0.02 1.05± 0.01 1.30± 007 0.40± 0.09
QU 0.18± 0.07 0.65± 0.07 0.86± 0.05 1.03± 0.02 1.06± 0.00 1.38± 0.04 0.66± 0.01
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
79
Table 3. The variation of α- amylase activity of 8 maize cultivars by 5% sorbitol treatment
Maize
Cultivars
The variation of α- amylase activity at the germinating stage by 5% sorbitol treatment (activity unit/mg)
1 day germ
maize
3 day germ
maize
5 day germ
maize
7 day germ
maize
9 day germ
maize
11 day germ
maize
14 day germ
maize
BG 0.0003±0.00 0.0081±0.00 0.0120±0.00 0.0930±0.04 0.1462±0.00 0.1641±0.00 0.0071±0.00
BK 0.0004±0.00 0.0033±0.00 0.0124±0.00 0.0640±0.02 0.0733±0.00 0.2024±0.00 0.0043±0.00
HL 0.0004±0.00 0.0014±0.00 0.0131±0.00 0.2063±0.06 0.2240±0.00 0.2430±0.00 0.0162±0.00
QH 0.0004±0.00 0.0040±0.00 0.0054±0.00 0.0114±0.00 0.0281±0.00 0.2073±0.01 0.0291±0.00
YM 0.0002±0.00 0.0062±0.00 0.0081±0.00 0.0642±0.00 0.0674±0.00 0.1934±0.00 0.0442±0.00
TL 0.0003±0.00 0.0051±0.00 0.0070±0.00 0.0463±0.01 0.0703±0.00 0.1942±0.00 0.0394±0.00
VN2 0.0002±0.00 0.0003±0.00 0.0022±0.00 0.0411±0.01 0.0681±0.00 0.1340±0.00 0.0110±0.00
QU 0.0004±0.00 0.0022±0.00 0.0061±0.00 0.0542±0.01 0.0612±0.00 0.1474±0.01 0.0042±0.00
* Study on the drought tolerance ability of
maize cultivars:
We assessed the drought tolerance ability of
maize cultivars at the plantlet stage by
factitious drought treatment. The results
showed the difference of the drought
tolerance ability (table 4).
The dryness index in maize cultivars were
from 10715.40 to 33763.98 and was highest
drought tolerance ability in HL cultivar.
The dissimilar coefficients of response of 8
maize cultivars were determined by
NTSYSpc- 2.02i program. The dendrogram
was established for two groups: BG, VN2 in
one, and BK, HL, TL, QU, QH, YM in other.
The similar coefficients of maize cultivars
were from 0% to 30.43% (fig 1).
By physiological and factitious drought
treatment, we selected HL cultivar with the
highest drought tolerance ability, and VN2
cultivar with the lowest.
Amplification and cloning of dehydrin
genes
Dehydrins are a group of proteins that are
accumulated during environmental stress such
as drought and low temperature or during late
embryogenesis. However, DHNs contain at
least one copy of a consensus 15-amino acid
sequence, the "K segment," which resembles
a class A2 amphipathic alpha-helical, lipid-
binding domain found in other proteins such
as apolipoproteins and alpha-synuclein. The
presence of the K segment raises the question
of whether DHNs bind lipids, bilayers, or
phospholipid vesicles (Allagulova et al., 2003
[1]; Yuxiu et al., 2007 [15]).
With the analysis of dehydrin gene sequence in
a maize cultivar in NCBI which has code
X15290, we design specific primer pair to
amplify and see dehydrin genes in maize
cultivars
( [7].
To isolate gene encoding dehydrin in genome
of maize cultivars, we segregated the DNA
total. The DNA concentration of 50 ng of all
sample was suitable to amplify the dehydrin
gene fragments. There are no visual
difference in the size of PCR products of all
DNA sources from eighth cultivars, the size
of the PCR product expected to be around 600
bp (Fig 2).
We selected HL and VN2 cultivar to clone.
The PCR products were inserted into the
cloning vector pTZ57R/T and transformed
into E.coli strain DH5α and selected by
blue/white technique. The results of gene
transfomation and selection shows in figure 3.
We choose white fungus colony grewn in LB
liqid medium containing 100 mg/l ampicillin
all night. PCR products of cloning are
checked by 1% agarose gel electrophoresis
(figure 3).
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
80
Table 4. The drought tolerance ability of maize cultivars at the plantlet stage
Maize cultivars BG BK HL QH YM TL VN2 QU
Dryness index 12799.96 22148.68 33763.98 18631.25 16727.51 25193.69 10715.40 17535.57
Figure 1. Phylogenetic tree of 8 maize cultivars
Figure 2. PCR products amplified using dehydrin genes specific primers and genomic DNA samples of
BK, HL, TL, QU, BG and VN2 maize cultivars; M: Marker 1kb
Figure 3. Result of PCR cloned products
M: Marker . 1. HL; 2.VN2
600bp→
M 1 2 3 4 5 6
M 1 2
800bp→
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
81
We can see the result of electrophoresis
shown in fig 3 that these PCR products which
are issued from white fungus colony are
positive. Most of the products are only one
band with right size. This improves that the
results of transfomation and cloning selection
are good and PCR is optimistic. We can
confirm that connecting PCR products with
clone vectors has good result. We choose
white fungus colony of researching samples
with these Plasmids were purified by
QIAprep Spin Miniprep Kit.
LEA is proteins group have playing
important on the water loss and the drought-
resistant ability of cell. When dehydration
occurs, messenger RNA appears in the seed
and is forming and increase of quantity,
including many different messenger RNA of
in the seeds and are decomposition all in the
process of germinating. The dehydrin (dhn)
are associated with phospholipid particles in
the final stages of embryo formation and
disappear very quickly start to germinate.
This capability of dhn enables prediction
about protection functions in the cell
membrane of phospholipid particles.
The level of transcription of LEA gene is
controlled by the absisis acid (ABA) and
dehydration and osmotic pressure of the cells.
A characteristics of the group of LEA proteins
include from 82 to 575 amino acids, rich in
hydrophobic amino acids (lysine, glycine),
does not contain cysteine and tryptophan, is
the α- helix and heat resistance (Close, 1996)
[2]. It replace the position of water in cells
and perform different functions such as ion
isolation and protection of proteins of
membrane, degrade denatured proteins and
adjust the osmotic pressure.
Introns exist in most of the genetic structure of
eukaryote cells and are noted research to find
out its function. In structure of intron is rich of
AT and have jump elements (transposone
element). The diversity in quantity and length of
introns can affect the function of gene
expression. Most of dehydrin genes have no
introns, but in some cases they also discovered
the small introns or SK2 Y2SK2 structured.
Dehydrin gene was isolated from genomic
DNA of maize Viet Nam in size is 0.65 kb and
have 121 bp of region introns, shorter than 16
bp of the Rab17 gene (Lien et al., 2007) [9].
The scientists found that some introns are in
positions of genes can promote of expression in
plants increases several times. Therefore
necessary to have further studies to elucidate the
role of introns in the structure of dehydrin gene.
Local glutinous maize cultivars in
mountainous northern of Vietnam have high
quality seeds and the drought-resistant ability,
in addition, local glutinous maize seeds are
resistant to termites. The problem is the
structure of dehydrin genes and other genes
isolated from the local glutinous maize related
to drought tolerance have what different with
the genes of other maize cultivars?
COCLUSIONS
By physiological and factitious drought
treatment, we selected HL cultivar with the
highest drought tolerance ability, and VN2
cultivar with the lowest. We have designed
one specific primer pair and isolated dehydrin
genes from two maize cultivars (Zea mays L.)
with PCR analysis. A 600 bp dehydrin gene
fragment from DNA genome of local maize
was successfully amplified. The PCR
products containing the dehydrin fragment
was cloned in pTZ57R/T vector and plasmids
were purified by QIAprep Spin Miniprep Kit
and sequenced. Should continue to clarify the
differences in genetic structure of local
mountain maize folds with other corn
varieties.
REFERENCES
[1]. Allagulova Ch. R., Gimalov F. R.,
Shakirova F. M., Vakhitov V. A. 2003. The
Plant Dehydrins: Structure and Putative
Functions, Biochemistry (Moscow), 68(9):
945-951.
[2]. Close T.J., 1996. Dehydrin: Emergence
biochemical role family plant dehydrin
proteins, Plant Physiol 97, 795-803.
[3]. Close T.J., 1989, Zea mays mRNA for
dehydrin (dhn1 gene), Plant Mol. Biol, 13 (1),
95- 108.
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82
82
[4]. Gawel N.J., Jarret R.L., 1991. Genomic
DNA isolation.
[5]. Glick R.B., Pasternak J.J., 1998,
Molecular Biotechnology, American Society
Microbiology.
[6]. Hong-Bo S., Zong-Suo L., Ming-An S.,
2005. LEA proteins in higher plants:
Structure, function, gene expression and
regulation, Colloids and surfaces B:
Biointerfaces, 45 (3-4): 131-135.
[7].
[8]. Lien TTP., Ton ND., Huong LTT., Cuong
BM., Tinh NH., 2005, Isolation of dehydrin
gene from Zea mays , Journal of
Biotechnology, 3(3): 347- 352.
[9]. Lien TTP., Thu VH., Cuong BM., 2007.
Polymorphism of dehydrin genes of several
Vietnamese maize cultivars. Journal of
Biotechnology 5(4): 485-491.
[10]. Mau CH., Anh NV, 2005. The
assessment of the quality of seeds and the
responsive ability to drought condition of
some local maize cultivars in mountainous
region. Science & Technology Journal of
Agriculture & Rural develpment, 66: 20-22.
[11]. Mau CH., Anh NV., 2006, The genetic
diversity of some local stichky and white
maize cultuvars with different drought ability.
Journal of Science &Technology, Thai
Nguyen University, 2 (38): 77-84
[12]. Mau CH., Thanh NTT., Nhan NT.,
2007. Reseach on gene of drought tolerance
of some upland local maize cultivars (Zea
mays L.) in the North of Vietnam. Bio-Hanoi
2007 - International Conference, December
18-19, 2007 Hanoi, Vietnam.
[13]. Nhan PT., Mau CH., Tam NT., 2007.
The response of some upland local sticky
corn cultivars (Zea mays L.) in tissue and
young phase. Proceeding, the 2007th National
Conference on Life Science. Science and
Technics Publishing House Hanoi, 784-788.
[14]. Rorat T., 2006. Plant dehydrin –tissue
location structure and function. Cell Mol Biol
Lett 11: 536-556.
[15]. Yuxiu Z., Zi W., Jin X., 2007.
Molecular mechanism of dehydrin in
response to environmental stress in plant,
Progress in Natural Science, 17 (3): 237- 246.
TÓM TẮT
ĐẶC TÍNH CHỊU HẠN CỦA MỘT SỐ GIỐNG NGÔ ĐỊA PHƢƠNG
(ZEA MAYS L.) Ở MIỀN NÖI PHÍA BẮC VIỆT NAM
Chu Hoàng Mậu1, Nguyễn Vũ Thanh Thanh2, Phạm Thị Thanh Nhàn1
1*Bộ môn Di truyền và Sinh học hiện đại, Khoa Sinh-KTNN, Trường Đại học Sư phạm
2 Bộ môn Di truyền, Khoa Khoa học Sự sống, Trường Đại học Khoa học
Ngô (Zea mays L.) là một trong những loại ngũ cốc đƣợc trồng rộng rãi ở Việt Nam. Các giống
ngô địa phƣơng đóng vai trò quan trọng trong đời sống của ngƣời dân sống ở khu vực miền núi
phía Bắc Việt Nam. Các giống ngô địa phƣơng miền núi có chất lƣợng hạt cao và có khả năng chịu
hạn tốt. Trong bài báo này, chúng tôi trình bày kết quả nghiên cứu khả năng chịu hạn và phân lập
gen dehydrin của một số giống ngô nếp địa phƣơng miền núi. Về khả năng chịu hạn, 6 giống ngô
có khả năng chịu hạn cao là: BK, HL, QH, YM, TL, và QU và hai giống ngô VN2 với BG có khả
năng chịu hạn thấp. Dehydrin - LEA (lete embryogenesis abundant) - D11 là loại protein trong họ
protein của thực vật bậc cao, một loại protein đƣợc tổng hợp khi gặp hạn hán hoặc stress nhiệt độ
thấp, chúng gồm có 6 loại protein dehydrin: dhn1, dhn2, dhn3, dhn4, dhn5, và dhn6. DHNs có
nhiều bản sao, nhƣng đều có một vùng bảo thủ giống nhau ở cả thực vật bậc cao và thực vật bậc
thấp gồm 15 acid amine: EKKGIMDKIKEKLPG (the K-segment). Chúng tôi đã nhân bản thành
công gen dhn1 từ ADN hệ gen của các giống ngô địa phƣơng miền núi với kích thƣớc là 0,6kb bởi
cặp mồi LeaZeM1. Sản phẩm PCR đã đƣợc tách dòng và giải trình tự.
Từ khóa: Dehydrin, hạn hán, miền núi, ngô, Dhnl, nhân bản, PCR
Tel:0913 383 289; Email:
[email protected]
Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên