The drought tolerant characteristics of some upland local maize cultivars (Zea mays L.) in the North of Viet Nam

By physiological and factitious drought treatment, we selected HL cultivar with the highest drought tolerance ability, and VN2 cultivar with the lowest. We have designed one specific primer pair and isolated dehydrin genes from two maize cultivars (Zea mays L.) with PCR analysis. A 600 bp dehydrin gene fragment from DNA genome of local maize was successfully amplified. The PCR products containing the dehydrin fragment was cloned in pTZ57R/T vector and plasmids were purified by QIAprep Spin Miniprep Kit and sequenced. Should continue to clarify the differences in genetic structure of local mountain maize folds with other corn varieties.

pdf6 trang | Chia sẻ: yendt2356 | Lượt xem: 867 | Lượt tải: 1Freedownload
Bạn đang xem nội dung tài liệu The drought tolerant characteristics of some upland local maize cultivars (Zea mays L.) in the North of Viet Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 77 THE DROUGHT TOLERANT CHARACTERISTICS OF SOME UPLAND LOCAL MAIZE CULTIVARS (ZEA MAYS L.) IN THE NORTH OF VIET NAM Chu Hoang Mau 1* , Nguyen Vu Thanh Thanh 2 , Pham Thi Thanh Nhan 1 1* Department of Genetics and Modern Biology, College of Education - TNU 2 Department of Genetics, College of Science - TNU SUMMARY Maize (Zea mays L.) is one of the widely grown grains in Viet Nam. The local upland maize cultivars play an important role for the life of people living in mountainous regions in the North of Viet Nam. The quality of seed and drought tolerance ability of local upland maize cultivars are good. In this work, we have studied drought tolerance character and dehydrin gene of some local upland maize cultivars. Among them these are six cultivars with high drought tolerance ability (BK, HL, QH, YM, TL, and QU) and two maize cultivars BG and VN2 with low drought tolerance ability. Dehydrin – LEA (lete embryogenesis abundant) – D11 is a plant protein family in a number of higher plants, a species of protein produced by plants during drought or low temperature stress. These are six dehydrin protein types of maize: dhn1, dhn2, dhn3, dhn4, dhn5, and dhn6. DHNs are unified by the presence of one or more copies of a putative amphipathic α - helix-forming domain (the K-segment), which is highly conserved in higher and lower plants and has a 15 residue consensus sequence EKKGIMDKIKEKLPG. We had cloned dhn1 gene from DNA of genome of local upland maize cultivars. The 0.6 kb of dhn1 gene was amplified by PCR and carry out successfully with LeaZeM1 primers. Cloning of PCR products and DNA sequencing is carrying out. Keywords: Dehydrin, drought, upland local, maize,Dhn1, cloning, PCR INTRODUCTION  Maize is widely cultivated throughout the world. Maize (Zea mays L.) is also one of the widely grown grains in Viet Nam. The local upland maize cultivars play an important role for the life of people living in mountainous regions in the North of Viet Nam. The quality of seeds, drought tolerance ability and resistant ability for of local upland maize cultivars are good. Therefore, the preservation of the gene resource of the local upland maize cultivars is now very necessary. To research on drought tolerance ability of local upland maize cultivars, we isolated dehydrin gene. Dehydrin – LEA (late embryogenesis abundant) – D11 and dehydrins are products of multigene families in a number of higher plants (Close, 1996) [2], a species of protein produced by plants during drought or low temperature stress. These are six dehydrin protein types of maize: dhn1, dhn2, dhn3, dhn4, dhn5, and dhn6. DHNs are unified by  Tel:0913 383 289; Email:[email protected] the presence of one or more copies of a putative amphipathic α -helix-forming domain (the K-segment), which is highly conserved in higher and lower plants and has a 15 residue consensus sequence EKKGIMDKIKEKLPG (Allagulova et al.,2003 [1]; Hong-Bo et al., 2005 [6]; Yuxiu et al. 2007 [15]). Dehydrins (DHNs; late embryogenesis abundant D-11) are a family of plant proteins induced in response to abiotic stresses such as drought, low temperature, and salinity or during the late stages of embryogenesis (Close, 1989 [3]; Allagulova et al., 2003 [1], Roat, 2006 [14]). In Viet Nam, quality of seeds, drought tolerance ability and resistant ability for of local upland maize cultivars in the North have are good (Mau and Anh, 2005 [10]; Nhan et al., 2007 [13]), they are diversity of phenotype and genotype (Mau and Anh., 2006 [11]). The genetic diversity and diversity of dehydrin gene of Viet Nam maize cultivars has been researched (Lien et al., 2005 [8]; Mau et al, 2007 [12]). Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 78 MATERIALS AND METHODS Eight local maize cultivars (BK, HL, QH, YM, TL, QU, BG and VN2) provided by the mountainous region of North in Viet Nam (Table 1). One specific primer pair, including: LeaZeM1F 5' ATGGAGTACGGTCAGCAGGGGC 3‟ LeaZeM1R 5' TCAGTGCTGTCCGGGCAGC 3' Cloning pTZ57R/T vectors. Both primers and vector are supplied by Fermentas. Definition of sugar content and α- amylase activity value at the germinating stage by 5% sorbitol treatment. Assessment of drought tolerance ability of eight maize cultivars at the plantlet stage by factitious drought treatment. Definition of the dissimilar coefficients of maize cultivars by the NTSYSpc- 2.02i program. Total DNA is separated from leaf of eight maize cultivars following the method of Gawel and Jarnet (Gawel et al., 1991) [4]. PCR is performed in a total volume of 50 μl. PCR conditions are: an initial denaturation step of 94 0 C for 3 min, followed by 30 cycles of 94 0 C for 30 sec, 57 0 C for 1 min and 72 0 C for 1 min. The final extension step is 72 0 C for 10 min. The PCR products are checked by 1% agarose gel electrophoresis. PCR products are cloned into pTZ57R/T (Glick et al., 1998) [5]. RESULTS AND DISCUSSIONS The drought tolerance ability of some local Vietnamese maize cultivars * The analysis of biochemistry characters at the germinating stage: We researched on sugar content and α- amylase activity in 8 maize cultivars at the germinating stage by 5% sorbitol treatment. The results have shown in table 2 and table 3. When treating physiological drought by 5% sorbitol treatment, sugar content and α- amylase activity were also increased from 1 to 11 day germ maize, and decreased at 14 day germ maize, highest at 11 day germ maize. HL cultivar had the highest sugar content and α- amylase activity, VN2 cultivar was lowest. Table 1. Origin of eight maize cultivars in the North of Vietnam Order Maize cultivars Wax/flint Origin 1 BG Wax Local Bacgiang cultivar 2 BK Wax Local Backan cultivar 3 HL Wax Local Halang-Cao Bang cultivar 4 QH Wax Local Quanghoa- Caobang cultivar 5 YM Wax Local Yenminh- Ha Giang cultivar 6 TL Wax Local Tralinh- Cao Bang cultivar 7 VN2 Wax Hybrids Vietnam cultivar 8 QU Flint Local Quanguyen- Cao Bang cultivar Table 2. The variation of sugar content of 8 maize cultivars by 5% sorbitol treatment Maize Cultivars The variation of sugar content at the germinating stage by 5% sorbitol treatment (%) 1 day germ maize 3 day germ maizet 5 day germ maizet 7 day germ maize 9 day germ maize 11 day germ maize 14 day germ maize BG 0.53± 0.08 0.65± 0.02 0.67± 0.06 1.04± 0.01 1.05± 0.01 1.32± 0.05 0.58± 0.01 BK 0.34± 0.03 0.40 ±0.08 0.79±0.01 1.04± 0.02 1.05± 0.01 1.33± 0.03 0.60± 0.01 HL 0.23± 0.03 0.52± 0.10 0.79± 0.01 1.05± 0.01 1.06± 0.01 1.39± 0.02 0.64± 0.03 QH 0.30± 0.05 0.59± 0.06 0.82± 0.03 1.05± 0.01 1.06± 0.00 1.34± 0.06 045± 0.09 YM 0.29± 0.02 0.57± 0.02 0.85± 0.03 1.05± 0.01 1.07± 0.00 1.32± 0.04 0.55± 0.09 TL 0.33± 0.03 0.60± 0.10 0.84± 0.11 1.05± 0.02 1.06± 0.00 1.35± 0.04 0.47± 0.07 VN2 0.18± 0.04 0.50± 0.03 0.68± 0.05 1.02± 0.02 1.05± 0.01 1.30± 007 0.40± 0.09 QU 0.18± 0.07 0.65± 0.07 0.86± 0.05 1.03± 0.02 1.06± 0.00 1.38± 0.04 0.66± 0.01 Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 79 Table 3. The variation of α- amylase activity of 8 maize cultivars by 5% sorbitol treatment Maize Cultivars The variation of α- amylase activity at the germinating stage by 5% sorbitol treatment (activity unit/mg) 1 day germ maize 3 day germ maize 5 day germ maize 7 day germ maize 9 day germ maize 11 day germ maize 14 day germ maize BG 0.0003±0.00 0.0081±0.00 0.0120±0.00 0.0930±0.04 0.1462±0.00 0.1641±0.00 0.0071±0.00 BK 0.0004±0.00 0.0033±0.00 0.0124±0.00 0.0640±0.02 0.0733±0.00 0.2024±0.00 0.0043±0.00 HL 0.0004±0.00 0.0014±0.00 0.0131±0.00 0.2063±0.06 0.2240±0.00 0.2430±0.00 0.0162±0.00 QH 0.0004±0.00 0.0040±0.00 0.0054±0.00 0.0114±0.00 0.0281±0.00 0.2073±0.01 0.0291±0.00 YM 0.0002±0.00 0.0062±0.00 0.0081±0.00 0.0642±0.00 0.0674±0.00 0.1934±0.00 0.0442±0.00 TL 0.0003±0.00 0.0051±0.00 0.0070±0.00 0.0463±0.01 0.0703±0.00 0.1942±0.00 0.0394±0.00 VN2 0.0002±0.00 0.0003±0.00 0.0022±0.00 0.0411±0.01 0.0681±0.00 0.1340±0.00 0.0110±0.00 QU 0.0004±0.00 0.0022±0.00 0.0061±0.00 0.0542±0.01 0.0612±0.00 0.1474±0.01 0.0042±0.00 * Study on the drought tolerance ability of maize cultivars: We assessed the drought tolerance ability of maize cultivars at the plantlet stage by factitious drought treatment. The results showed the difference of the drought tolerance ability (table 4). The dryness index in maize cultivars were from 10715.40 to 33763.98 and was highest drought tolerance ability in HL cultivar. The dissimilar coefficients of response of 8 maize cultivars were determined by NTSYSpc- 2.02i program. The dendrogram was established for two groups: BG, VN2 in one, and BK, HL, TL, QU, QH, YM in other. The similar coefficients of maize cultivars were from 0% to 30.43% (fig 1). By physiological and factitious drought treatment, we selected HL cultivar with the highest drought tolerance ability, and VN2 cultivar with the lowest. Amplification and cloning of dehydrin genes Dehydrins are a group of proteins that are accumulated during environmental stress such as drought and low temperature or during late embryogenesis. However, DHNs contain at least one copy of a consensus 15-amino acid sequence, the "K segment," which resembles a class A2 amphipathic alpha-helical, lipid- binding domain found in other proteins such as apolipoproteins and alpha-synuclein. The presence of the K segment raises the question of whether DHNs bind lipids, bilayers, or phospholipid vesicles (Allagulova et al., 2003 [1]; Yuxiu et al., 2007 [15]). With the analysis of dehydrin gene sequence in a maize cultivar in NCBI which has code X15290, we design specific primer pair to amplify and see dehydrin genes in maize cultivars ( [7]. To isolate gene encoding dehydrin in genome of maize cultivars, we segregated the DNA total. The DNA concentration of 50 ng of all sample was suitable to amplify the dehydrin gene fragments. There are no visual difference in the size of PCR products of all DNA sources from eighth cultivars, the size of the PCR product expected to be around 600 bp (Fig 2). We selected HL and VN2 cultivar to clone. The PCR products were inserted into the cloning vector pTZ57R/T and transformed into E.coli strain DH5α and selected by blue/white technique. The results of gene transfomation and selection shows in figure 3. We choose white fungus colony grewn in LB liqid medium containing 100 mg/l ampicillin all night. PCR products of cloning are checked by 1% agarose gel electrophoresis (figure 3). Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 80 Table 4. The drought tolerance ability of maize cultivars at the plantlet stage Maize cultivars BG BK HL QH YM TL VN2 QU Dryness index 12799.96 22148.68 33763.98 18631.25 16727.51 25193.69 10715.40 17535.57 Figure 1. Phylogenetic tree of 8 maize cultivars Figure 2. PCR products amplified using dehydrin genes specific primers and genomic DNA samples of BK, HL, TL, QU, BG and VN2 maize cultivars; M: Marker 1kb Figure 3. Result of PCR cloned products M: Marker . 1. HL; 2.VN2 600bp→ M 1 2 3 4 5 6 M 1 2 800bp→ Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 81 We can see the result of electrophoresis shown in fig 3 that these PCR products which are issued from white fungus colony are positive. Most of the products are only one band with right size. This improves that the results of transfomation and cloning selection are good and PCR is optimistic. We can confirm that connecting PCR products with clone vectors has good result. We choose white fungus colony of researching samples with these Plasmids were purified by QIAprep Spin Miniprep Kit. LEA is proteins group have playing important on the water loss and the drought- resistant ability of cell. When dehydration occurs, messenger RNA appears in the seed and is forming and increase of quantity, including many different messenger RNA of in the seeds and are decomposition all in the process of germinating. The dehydrin (dhn) are associated with phospholipid particles in the final stages of embryo formation and disappear very quickly start to germinate. This capability of dhn enables prediction about protection functions in the cell membrane of phospholipid particles. The level of transcription of LEA gene is controlled by the absisis acid (ABA) and dehydration and osmotic pressure of the cells. A characteristics of the group of LEA proteins include from 82 to 575 amino acids, rich in hydrophobic amino acids (lysine, glycine), does not contain cysteine and tryptophan, is the α- helix and heat resistance (Close, 1996) [2]. It replace the position of water in cells and perform different functions such as ion isolation and protection of proteins of membrane, degrade denatured proteins and adjust the osmotic pressure. Introns exist in most of the genetic structure of eukaryote cells and are noted research to find out its function. In structure of intron is rich of AT and have jump elements (transposone element). The diversity in quantity and length of introns can affect the function of gene expression. Most of dehydrin genes have no introns, but in some cases they also discovered the small introns or SK2 Y2SK2 structured. Dehydrin gene was isolated from genomic DNA of maize Viet Nam in size is 0.65 kb and have 121 bp of region introns, shorter than 16 bp of the Rab17 gene (Lien et al., 2007) [9]. The scientists found that some introns are in positions of genes can promote of expression in plants increases several times. Therefore necessary to have further studies to elucidate the role of introns in the structure of dehydrin gene. Local glutinous maize cultivars in mountainous northern of Vietnam have high quality seeds and the drought-resistant ability, in addition, local glutinous maize seeds are resistant to termites. The problem is the structure of dehydrin genes and other genes isolated from the local glutinous maize related to drought tolerance have what different with the genes of other maize cultivars? COCLUSIONS By physiological and factitious drought treatment, we selected HL cultivar with the highest drought tolerance ability, and VN2 cultivar with the lowest. We have designed one specific primer pair and isolated dehydrin genes from two maize cultivars (Zea mays L.) with PCR analysis. A 600 bp dehydrin gene fragment from DNA genome of local maize was successfully amplified. The PCR products containing the dehydrin fragment was cloned in pTZ57R/T vector and plasmids were purified by QIAprep Spin Miniprep Kit and sequenced. Should continue to clarify the differences in genetic structure of local mountain maize folds with other corn varieties. REFERENCES [1]. Allagulova Ch. R., Gimalov F. R., Shakirova F. M., Vakhitov V. A. 2003. The Plant Dehydrins: Structure and Putative Functions, Biochemistry (Moscow), 68(9): 945-951. [2]. Close T.J., 1996. Dehydrin: Emergence biochemical role family plant dehydrin proteins, Plant Physiol 97, 795-803. [3]. Close T.J., 1989, Zea mays mRNA for dehydrin (dhn1 gene), Plant Mol. Biol, 13 (1), 95- 108. Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên Chu Hoàng Mậu và cs Tạp chí KHOA HỌC & CÔNG NGHỆ 77(01): 77 - 82 82 [4]. Gawel N.J., Jarret R.L., 1991. Genomic DNA isolation. [5]. Glick R.B., Pasternak J.J., 1998, Molecular Biotechnology, American Society Microbiology. [6]. Hong-Bo S., Zong-Suo L., Ming-An S., 2005. LEA proteins in higher plants: Structure, function, gene expression and regulation, Colloids and surfaces B: Biointerfaces, 45 (3-4): 131-135. [7]. [8]. Lien TTP., Ton ND., Huong LTT., Cuong BM., Tinh NH., 2005, Isolation of dehydrin gene from Zea mays , Journal of Biotechnology, 3(3): 347- 352. [9]. Lien TTP., Thu VH., Cuong BM., 2007. Polymorphism of dehydrin genes of several Vietnamese maize cultivars. Journal of Biotechnology 5(4): 485-491. [10]. Mau CH., Anh NV, 2005. The assessment of the quality of seeds and the responsive ability to drought condition of some local maize cultivars in mountainous region. Science & Technology Journal of Agriculture & Rural develpment, 66: 20-22. [11]. Mau CH., Anh NV., 2006, The genetic diversity of some local stichky and white maize cultuvars with different drought ability. Journal of Science &Technology, Thai Nguyen University, 2 (38): 77-84 [12]. Mau CH., Thanh NTT., Nhan NT., 2007. Reseach on gene of drought tolerance of some upland local maize cultivars (Zea mays L.) in the North of Vietnam. Bio-Hanoi 2007 - International Conference, December 18-19, 2007 Hanoi, Vietnam. [13]. Nhan PT., Mau CH., Tam NT., 2007. The response of some upland local sticky corn cultivars (Zea mays L.) in tissue and young phase. Proceeding, the 2007th National Conference on Life Science. Science and Technics Publishing House Hanoi, 784-788. [14]. Rorat T., 2006. Plant dehydrin –tissue location structure and function. Cell Mol Biol Lett 11: 536-556. [15]. Yuxiu Z., Zi W., Jin X., 2007. Molecular mechanism of dehydrin in response to environmental stress in plant, Progress in Natural Science, 17 (3): 237- 246. TÓM TẮT ĐẶC TÍNH CHỊU HẠN CỦA MỘT SỐ GIỐNG NGÔ ĐỊA PHƢƠNG (ZEA MAYS L.) Ở MIỀN NÖI PHÍA BẮC VIỆT NAM Chu Hoàng Mậu1, Nguyễn Vũ Thanh Thanh2, Phạm Thị Thanh Nhàn1 1*Bộ môn Di truyền và Sinh học hiện đại, Khoa Sinh-KTNN, Trường Đại học Sư phạm 2 Bộ môn Di truyền, Khoa Khoa học Sự sống, Trường Đại học Khoa học Ngô (Zea mays L.) là một trong những loại ngũ cốc đƣợc trồng rộng rãi ở Việt Nam. Các giống ngô địa phƣơng đóng vai trò quan trọng trong đời sống của ngƣời dân sống ở khu vực miền núi phía Bắc Việt Nam. Các giống ngô địa phƣơng miền núi có chất lƣợng hạt cao và có khả năng chịu hạn tốt. Trong bài báo này, chúng tôi trình bày kết quả nghiên cứu khả năng chịu hạn và phân lập gen dehydrin của một số giống ngô nếp địa phƣơng miền núi. Về khả năng chịu hạn, 6 giống ngô có khả năng chịu hạn cao là: BK, HL, QH, YM, TL, và QU và hai giống ngô VN2 với BG có khả năng chịu hạn thấp. Dehydrin - LEA (lete embryogenesis abundant) - D11 là loại protein trong họ protein của thực vật bậc cao, một loại protein đƣợc tổng hợp khi gặp hạn hán hoặc stress nhiệt độ thấp, chúng gồm có 6 loại protein dehydrin: dhn1, dhn2, dhn3, dhn4, dhn5, và dhn6. DHNs có nhiều bản sao, nhƣng đều có một vùng bảo thủ giống nhau ở cả thực vật bậc cao và thực vật bậc thấp gồm 15 acid amine: EKKGIMDKIKEKLPG (the K-segment). Chúng tôi đã nhân bản thành công gen dhn1 từ ADN hệ gen của các giống ngô địa phƣơng miền núi với kích thƣớc là 0,6kb bởi cặp mồi LeaZeM1. Sản phẩm PCR đã đƣợc tách dòng và giải trình tự. Từ khóa: Dehydrin, hạn hán, miền núi, ngô, Dhnl, nhân bản, PCR  Tel:0913 383 289; Email:[email protected] Số hóa bởi Trung tâm Học liệu - Đại học Thái Nguyên

Các file đính kèm theo tài liệu này:

  • pdfbrief_33349_37172_3920122016714_859_2052404.pdf